ID: 1036215791

View in Genome Browser
Species Human (GRCh38)
Location 8:6878565-6878587
Sequence CAGAGCTACAACTGCCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036215774_1036215791 30 Left 1036215774 8:6878512-6878534 CCCCAGTGTGGCCCTTGGAGGGT No data
Right 1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG No data
1036215776_1036215791 28 Left 1036215776 8:6878514-6878536 CCAGTGTGGCCCTTGGAGGGTGA No data
Right 1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG No data
1036215786_1036215791 -8 Left 1036215786 8:6878550-6878572 CCTGGGCCCACCCTGCAGAGCTA No data
Right 1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG No data
1036215782_1036215791 18 Left 1036215782 8:6878524-6878546 CCTTGGAGGGTGAGGGTCTGGGC No data
Right 1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG No data
1036215785_1036215791 -4 Left 1036215785 8:6878546-6878568 CCAGCCTGGGCCCACCCTGCAGA No data
Right 1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG No data
1036215775_1036215791 29 Left 1036215775 8:6878513-6878535 CCCAGTGTGGCCCTTGGAGGGTG No data
Right 1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG No data
1036215780_1036215791 19 Left 1036215780 8:6878523-6878545 CCCTTGGAGGGTGAGGGTCTGGG No data
Right 1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036215791 Original CRISPR CAGAGCTACAACTGCCAGAT TGG Intergenic
No off target data available for this crispr