ID: 1036215889

View in Genome Browser
Species Human (GRCh38)
Location 8:6879457-6879479
Sequence CTTCAATAAGACAGAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036215889_1036215892 1 Left 1036215889 8:6879457-6879479 CCTTTCCTTCTGTCTTATTGAAG No data
Right 1036215892 8:6879481-6879503 CACACTATGATTCTTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036215889 Original CRISPR CTTCAATAAGACAGAAGGAA AGG (reversed) Intergenic
No off target data available for this crispr