ID: 1036215890

View in Genome Browser
Species Human (GRCh38)
Location 8:6879462-6879484
Sequence TGTGGCTTCAATAAGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036215890_1036215892 -4 Left 1036215890 8:6879462-6879484 CCTTCTGTCTTATTGAAGCCACA No data
Right 1036215892 8:6879481-6879503 CACACTATGATTCTTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036215890 Original CRISPR TGTGGCTTCAATAAGACAGA AGG (reversed) Intergenic
No off target data available for this crispr