ID: 1036215892

View in Genome Browser
Species Human (GRCh38)
Location 8:6879481-6879503
Sequence CACACTATGATTCTTTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036215890_1036215892 -4 Left 1036215890 8:6879462-6879484 CCTTCTGTCTTATTGAAGCCACA No data
Right 1036215892 8:6879481-6879503 CACACTATGATTCTTTGACCAGG No data
1036215888_1036215892 2 Left 1036215888 8:6879456-6879478 CCCTTTCCTTCTGTCTTATTGAA No data
Right 1036215892 8:6879481-6879503 CACACTATGATTCTTTGACCAGG No data
1036215889_1036215892 1 Left 1036215889 8:6879457-6879479 CCTTTCCTTCTGTCTTATTGAAG No data
Right 1036215892 8:6879481-6879503 CACACTATGATTCTTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036215892 Original CRISPR CACACTATGATTCTTTGACC AGG Intergenic
No off target data available for this crispr