ID: 1036220248

View in Genome Browser
Species Human (GRCh38)
Location 8:6915237-6915259
Sequence GATGAGTGACTAGCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036220246_1036220248 0 Left 1036220246 8:6915214-6915236 CCTGATAAATGATGAGGAGAGTG No data
Right 1036220248 8:6915237-6915259 GATGAGTGACTAGCAAAGCCTGG No data
1036220240_1036220248 29 Left 1036220240 8:6915185-6915207 CCCTGCACATCACAGGGGCTTGG No data
Right 1036220248 8:6915237-6915259 GATGAGTGACTAGCAAAGCCTGG No data
1036220242_1036220248 28 Left 1036220242 8:6915186-6915208 CCTGCACATCACAGGGGCTTGGG No data
Right 1036220248 8:6915237-6915259 GATGAGTGACTAGCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036220248 Original CRISPR GATGAGTGACTAGCAAAGCC TGG Intergenic
No off target data available for this crispr