ID: 1036221548

View in Genome Browser
Species Human (GRCh38)
Location 8:6925173-6925195
Sequence CAAACTGGAGACAGTCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036221548_1036221553 26 Left 1036221548 8:6925173-6925195 CCCATATGACTGTCTCCAGTTTG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1036221553 8:6925222-6925244 AAAAACATTCCTTTAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036221548 Original CRISPR CAAACTGGAGACAGTCATAT GGG (reversed) Intronic
901386148 1:8910576-8910598 CAGGCTGGAGACAGACATCTGGG + Intergenic
902761418 1:18583364-18583386 CAACCTTGGGACAGTCAGATTGG - Intergenic
906366644 1:45215662-45215684 TGAATTGGAGACAGTCATTTTGG - Intronic
910483247 1:87681884-87681906 CCAAGTGCAGACAGCCATATTGG + Intergenic
911005919 1:93223811-93223833 CAATCTGGAGACAACCAGATAGG - Intronic
911154935 1:94628021-94628043 CAAACTGGTCATAGTCATTTAGG - Intergenic
912238045 1:107873923-107873945 TAAACTTGAGACAGAAATATAGG - Intronic
913451591 1:118996512-118996534 CAACCTGGAGGCAGTCACCTAGG + Intergenic
917190103 1:172407312-172407334 CAAATTGGAGAAAGTCAAAAAGG + Intronic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
1063442592 10:6085180-6085202 CTATCTGGAGCCAGCCATATTGG + Intergenic
1065997905 10:31076487-31076509 CAAACTCCAGTCAGCCATATTGG + Intergenic
1066018502 10:31272560-31272582 CAATCTGGAGAAAGACACATGGG - Intergenic
1066767802 10:38818513-38818535 CAAAGTGGAATCAATCATATTGG - Intergenic
1067712704 10:48662632-48662654 CAAACTGGAAACAGTCAAGATGG + Intergenic
1067986353 10:51150664-51150686 CAAACTGGAGGCTTCCATATAGG - Intronic
1069141044 10:64825849-64825871 CCACCTGGAGACAGTCATTTTGG + Intergenic
1070638105 10:78145465-78145487 CATGCTGGAGACAGTCCTCTGGG + Intergenic
1071969853 10:90893128-90893150 CAAACTAGAATCAGACATATAGG + Intronic
1072118610 10:92386774-92386796 CAAGATGGAGTCAGTCATGTAGG + Intergenic
1073167448 10:101469202-101469224 CAAACTGGAGAGAGTCTTACAGG + Intronic
1074396276 10:113100624-113100646 TTAACTGAAGACAGTCATTTTGG - Intronic
1078669424 11:13351890-13351912 AAAACTGGAGACAGAGAAATGGG + Intronic
1079557310 11:21775263-21775285 CAAAATGGAAACCGTCTTATTGG - Intergenic
1085333471 11:75671643-75671665 CAAACAGGTGTGAGTCATATGGG - Intergenic
1086560084 11:88157218-88157240 TAAACTGGCAACAGTCAAATAGG + Intronic
1088972542 11:114786692-114786714 CAAACTAGAAACAATGATATGGG - Intergenic
1093943085 12:25076553-25076575 CAAACTGGAAACTGGCATAATGG + Intronic
1095238375 12:39827147-39827169 TAAACTGGAGACATCCATAGAGG - Intronic
1104169769 12:126268819-126268841 CAAGCTGGAGCCAGTCCTCTGGG - Intergenic
1104219863 12:126772479-126772501 GAAACTTGAACCAGTCATATAGG - Intergenic
1104388016 12:128367496-128367518 CAAACTGGAGCCCATCAGATGGG - Intronic
1108401142 13:50045294-50045316 CAAACTGCACATAGTTATATAGG - Intergenic
1108638205 13:52357033-52357055 CAAAGTGGGGACAGTCTTATAGG + Intergenic
1108788200 13:53932669-53932691 CAGACTGGACTCAGTCATCTTGG + Intergenic
1111620591 13:90720139-90720161 CAATCTGGAAACAAGCATATTGG - Intergenic
1112034812 13:95487226-95487248 CAAACAGGAGATAGTCTTCTTGG - Intronic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1117076033 14:52105508-52105530 CAAAATGGAGACAGCCATTATGG + Intergenic
1117735831 14:58767443-58767465 CAAACAGGAGACATTCAGGTTGG - Intergenic
1118715285 14:68555500-68555522 GAAACTGGAAACAGGCATGTGGG + Intronic
1121532162 14:94662583-94662605 ACAACTTGAGAGAGTCATATGGG - Intergenic
1122611006 14:102983403-102983425 CAAACTGGGGACAGGCAGATTGG - Intronic
1123910116 15:24957340-24957362 AAAAGTGGAGACAATCTTATTGG + Intronic
1126201109 15:45987254-45987276 CACACTGGAGCCTGTCATACTGG + Intergenic
1127346550 15:58106827-58106849 CATACTTGAGCCAGTGATATAGG - Intronic
1129672459 15:77614808-77614830 CAACCTGGAGACACTCATCCTGG - Exonic
1130435981 15:83900393-83900415 CATTCTGGAGGCAGTTATATAGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1139104248 16:63807318-63807340 CAAAGAAGAGACAGTCTTATTGG + Intergenic
1139143144 16:64292666-64292688 CAAGATGGAGTCAGTCATATCGG - Intergenic
1143192422 17:5049738-5049760 CAAACTACAGACACTCATTTTGG + Intronic
1143411153 17:6709928-6709950 CAACCTGGAGACAGTCTTACTGG - Intronic
1144120503 17:12148041-12148063 GAAAAGGTAGACAGTCATATAGG + Intergenic
1148327916 17:46794628-46794650 CAAACTTTCGACAGTCCTATTGG + Intronic
1149251427 17:54774561-54774583 CAATTTGCAGACAGTGATATGGG - Intergenic
1155181163 18:23348790-23348812 AAAAATAGAGACTGTCATATTGG - Intronic
1155647440 18:28095922-28095944 AAAACTGGAGAGAGGCATAAAGG + Intronic
1155937406 18:31767931-31767953 CAAAATGTAGACATCCATATGGG - Intergenic
1156921730 18:42530363-42530385 CTATAGGGAGACAGTCATATAGG - Intergenic
1159351806 18:67284996-67285018 CAAAAGGGAGAAAGCCATATTGG - Intergenic
1159356531 18:67343574-67343596 CTATGTGGAGAAAGTCATATAGG - Intergenic
1159888079 18:73928338-73928360 CAAACTGGGGACATTGACATTGG + Intergenic
1164021865 19:21314715-21314737 AAAACTGGAGAAATTCATCTGGG + Intronic
1164842260 19:31401364-31401386 GAAATTGGAGACAGTAATCTGGG - Intergenic
1166782818 19:45351267-45351289 GAAACTGGAGACAGGCACAGGGG - Exonic
1168487696 19:56778706-56778728 CAAACTGGCTAAAGTCATAGAGG - Intronic
924984719 2:260084-260106 CAAAATGCAGACAGTAGTATTGG - Intronic
926787418 2:16531765-16531787 CCAGCTGGAGAGAGTCAAATTGG + Intergenic
928929914 2:36613921-36613943 CAAAGTAGAGAAAGTCATTTGGG - Intronic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
932733168 2:74234804-74234826 GGAACTGGAGACACTCAAATAGG + Intronic
936529990 2:113269299-113269321 CAGACTGGAGAAAGCCAGATGGG + Intronic
937105535 2:119308838-119308860 CAAACTTGAGAAAGTCTTATTGG + Intronic
939217007 2:139251333-139251355 CAAACTGCTGTCAGTCATCTGGG + Intergenic
939624034 2:144454707-144454729 ATAAGTGGAGACAGTCATGTGGG - Intronic
939948339 2:148437691-148437713 CATACTAAAGACAGTCACATAGG + Intronic
940612032 2:156005061-156005083 AAAAATGGAAACAGGCATATAGG + Intergenic
942737963 2:179138491-179138513 CAAAATGGAGTCACTAATATTGG + Intronic
943520167 2:188939307-188939329 GAAATTGGAGAAACTCATATAGG + Intergenic
944793484 2:203158770-203158792 AAAACTGGAGAAAGTCTTTTAGG - Intronic
947443831 2:230148055-230148077 CAGACAGGACACAGACATATGGG + Intergenic
1170813430 20:19693263-19693285 TAAACTGGAAACAGTGAAATGGG + Exonic
1170972345 20:21127685-21127707 CACACTGGACACAGTTATAGAGG + Intronic
1177528963 21:22336454-22336476 CTAACAGCATACAGTCATATGGG + Intergenic
1177548803 21:22594568-22594590 CAAAATGGACACAGGCAAATAGG - Intergenic
1178136038 21:29628679-29628701 CAAACCTGAGACATTCATATAGG + Intronic
1178902363 21:36607480-36607502 CAGAATGGAGACACTCATTTGGG - Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1182398413 22:30054725-30054747 TTAACTGGAGGCAGTCATATAGG + Intergenic
1182933880 22:34201622-34201644 CAAAATGGAGACAGACACACAGG + Intergenic
1184074701 22:42168864-42168886 CAAACAGGAGACATTCAGACAGG + Intronic
949290525 3:2460315-2460337 CAAAGTGGAAACAGTCAGAATGG - Intronic
950411666 3:12842008-12842030 CAAAATGGAGACAATAATAGGGG - Intronic
954944417 3:54407147-54407169 CAAAGTGGAGACTGACAGATTGG - Intronic
957009477 3:74987018-74987040 CAAAATGAAGACATTAATATTGG - Intergenic
957813699 3:85262754-85262776 CAAATTTGAGGCAGTCATTTAGG - Intronic
959233118 3:103683022-103683044 CAAGATGGGGACAGTCATACAGG + Intergenic
962004144 3:131331418-131331440 CAAACTGGAGACATTGCTAATGG - Intronic
962710420 3:138081326-138081348 CAAACAGGACACATTCACATGGG + Intronic
962926645 3:139999683-139999705 CAAATTGGAGACAGACAATTTGG + Intronic
965732404 3:171786058-171786080 CAAACTGGAAACAGTATTATAGG + Intronic
966280096 3:178215923-178215945 GGAAATGGAGAAAGTCATATGGG + Intergenic
967426443 3:189332801-189332823 CAAACTCCAGCCAGCCATATTGG - Intergenic
971932822 4:33107103-33107125 AAAACTGGAGAGAGACATCTAGG - Intergenic
972062470 4:34894398-34894420 CAAATGGGAAACAGACATATAGG + Intergenic
973157132 4:46969964-46969986 TATACTGGAGAAACTCATATGGG - Intronic
973796323 4:54430892-54430914 AAAACTGGAAATAGTCATGTTGG + Intergenic
977169095 4:93738381-93738403 CAAATTGGAGACAGAGATAGTGG + Intronic
979394003 4:120163907-120163929 CTAACTCAATACAGTCATATTGG - Intergenic
979983693 4:127289048-127289070 CAAACTGGAGAGACTCATTATGG - Intergenic
980556172 4:134408504-134408526 CACACTGAACACAATCATATTGG - Intergenic
980573172 4:134650070-134650092 CAAACTACATACAGCCATATTGG - Intergenic
980900442 4:138900216-138900238 GAAACTGGAGGCAGTAATTTGGG + Intergenic
981847988 4:149191710-149191732 CAAACTGAAGACAGCTATGTTGG + Intergenic
982512373 4:156299254-156299276 CAAAATGGAGATACTCATCTTGG - Intergenic
983007806 4:162507028-162507050 GATATTGGTGACAGTCATATTGG - Intergenic
988386444 5:30572390-30572412 AAAAGTGGAGACAGTCAGGTGGG + Intergenic
993352658 5:86868926-86868948 CAAAATGGAGTCAGTCATGCTGG + Intergenic
993371976 5:87103684-87103706 CAAACTTGATACATTCATTTTGG - Intergenic
993490696 5:88543770-88543792 CATACAGTACACAGTCATATTGG + Intergenic
997898631 5:137742758-137742780 TAAAATGGAGACAGTAAGATAGG - Intergenic
998947572 5:147356487-147356509 GAAGCTGGAGACAGTCATAGGGG + Intronic
999071254 5:148746067-148746089 CAAACTGGGGCCAGTCGGATGGG - Intergenic
999220518 5:149972730-149972752 AAAAATGGAGACTGTCAGATAGG - Intronic
1000675691 5:164120000-164120022 CAAACTGGAGCCAGACTTGTGGG - Intergenic
1001970423 5:175950914-175950936 CAAACTGGAGTCAGACACACTGG + Intronic
1002247014 5:177892847-177892869 CAAACTGGAGTCAGACACACTGG - Intergenic
1005265193 6:24104987-24105009 CAAACTGTAGACAGTGAAACCGG - Intergenic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1009491071 6:64292004-64292026 TAAAGTGGAGACAATAATATTGG - Intronic
1009627055 6:66147295-66147317 CAAAATGGAGATAGTCATGCGGG - Intergenic
1011170402 6:84498616-84498638 CAAACTGGACACAGACAACTTGG - Intergenic
1014434223 6:121403523-121403545 CCAACTGGAGGCAGTGATCTTGG - Intergenic
1015099727 6:129462366-129462388 CAAGCTGAAGGCAGGCATATGGG - Intronic
1015239962 6:131011245-131011267 AAAACTGGAGCCATTCATAAAGG + Intronic
1017436648 6:154421796-154421818 CAAACTGTATACAGTTATGTAGG + Intronic
1020139089 7:5603022-5603044 CTAACTGGGGAAAGTCATGTGGG + Intronic
1020465771 7:8477137-8477159 TAAAATGGAGACAACCATATGGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021296897 7:18919303-18919325 CAAACTGGTTACCATCATATTGG - Intronic
1022380145 7:29851836-29851858 CACAGTGGGGACAGTCCTATAGG + Intronic
1023120508 7:36903891-36903913 CTCACTGGGGACAGTCAGATTGG + Intronic
1023287879 7:38637902-38637924 CCAACTGGAAACAGGCTTATTGG - Intergenic
1023570991 7:41571732-41571754 CAAAGTGGAGAGAGTTTTATTGG + Intergenic
1024445304 7:49470715-49470737 GAAACTGGAGATAGTCTTATGGG + Intergenic
1024897209 7:54273922-54273944 AAATCTGCAGATAGTCATATTGG + Intergenic
1033334505 7:140440957-140440979 CAAACTTTAGCCAGGCATATTGG - Intergenic
1036103167 8:5810115-5810137 CTAACAGGAGAGACTCATATTGG - Intergenic
1036221548 8:6925173-6925195 CAAACTGGAGACAGTCATATGGG - Intronic
1036757066 8:11477603-11477625 CAAGCTGGAGACAGCCCTGTGGG - Intergenic
1037092589 8:14941188-14941210 CAAAATGTAGAAAGTTATATTGG - Intronic
1038207190 8:25477777-25477799 CAAACTGAACATAGTCAAATAGG + Intronic
1040129162 8:43774384-43774406 CAAGCTGGAAACAGTCTTTTTGG + Intergenic
1041325384 8:56658076-56658098 AAAAGTCAAGACAGTCATATGGG - Intergenic
1041462922 8:58131523-58131545 AAAACAGGAGACGGTGATATAGG - Intronic
1041703691 8:60821364-60821386 TAAACTGGAAACAGTATTATTGG - Intronic
1044772506 8:95651825-95651847 CAAACTGGAGACAAACAAAAAGG - Intergenic
1045734195 8:105276127-105276149 CAAGATGGAGTCAGCCATATTGG - Intronic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047603613 8:126452249-126452271 CAAACTAAAGGCAGTAATATGGG - Intergenic
1050793525 9:9506199-9506221 AAACATGGAGACAGTTATATAGG - Intronic
1051226170 9:14901462-14901484 AAAGCTGGAGGCAGTAATATGGG - Intronic
1051685683 9:19656003-19656025 CAACCGGGAGACAGTGATTTAGG - Intronic
1052360107 9:27545400-27545422 CAAGCTGGAGATTGTCAGATTGG + Intergenic
1052531036 9:29684143-29684165 CAAAATAGGGATAGTCATATGGG + Intergenic
1053017392 9:34670351-34670373 TAAACTGGGGACAGTCTTGTTGG + Intergenic
1054737459 9:68769923-68769945 GAAACTGGAGGCAGTGAGATAGG - Intronic
1055597802 9:77883286-77883308 CCATCTGGAGACTCTCATATAGG - Intronic
1057049015 9:91907906-91907928 CCACCTGGAGGCAGTCATGTAGG - Intronic
1057056472 9:91965417-91965439 CAGACTGGAGATGGTCATTTGGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058139975 9:101347278-101347300 CAATATGGAGACAGCCTTATTGG + Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059511716 9:114854602-114854624 TAAAATGGAGGCAGTCTTATGGG - Intergenic
1059708844 9:116848884-116848906 GAAATTGGAGGCAGTCTTATGGG - Intronic
1061751495 9:132780646-132780668 CAAACTGGAAACTGCTATATAGG - Intronic
1185950954 X:4433476-4433498 CATATTGGAGACAGATATATAGG + Intergenic
1187059466 X:15772217-15772239 AAAACTGGACACAATAATATAGG + Intronic
1187827810 X:23350206-23350228 CAAACTGGACAGAGTTAAATAGG - Intronic
1188308521 X:28587823-28587845 CTAACTGGAGACAGTCTTGTAGG + Exonic
1189377496 X:40476909-40476931 CAAATTGGAGACTGACATCTTGG + Intergenic
1192737425 X:73862393-73862415 GAAACTGAAGCTAGTCATATAGG + Intergenic
1193329585 X:80221337-80221359 CTAACAGCATACAGTCATATGGG + Intergenic
1194893059 X:99404540-99404562 CAAACTGTAGCCATTCATTTAGG + Intergenic
1196658140 X:118241357-118241379 CAAACTGGAATCAGTCAAAGAGG - Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1199719781 X:150534653-150534675 CAGACTGGAGATAGGAATATGGG + Intergenic
1201567537 Y:15382754-15382776 CACACTGGAGACAGTAAGAGTGG - Intergenic