ID: 1036222245

View in Genome Browser
Species Human (GRCh38)
Location 8:6930541-6930563
Sequence CTTCCTCAAAACACGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036222245_1036222251 9 Left 1036222245 8:6930541-6930563 CCAGACACCGTGTTTTGAGGAAG No data
Right 1036222251 8:6930573-6930595 CGCACAGGAAGATGAACTGAGGG No data
1036222245_1036222253 21 Left 1036222245 8:6930541-6930563 CCAGACACCGTGTTTTGAGGAAG No data
Right 1036222253 8:6930585-6930607 TGAACTGAGGGCACCTGCGAGGG No data
1036222245_1036222250 8 Left 1036222245 8:6930541-6930563 CCAGACACCGTGTTTTGAGGAAG No data
Right 1036222250 8:6930572-6930594 TCGCACAGGAAGATGAACTGAGG No data
1036222245_1036222247 -6 Left 1036222245 8:6930541-6930563 CCAGACACCGTGTTTTGAGGAAG No data
Right 1036222247 8:6930558-6930580 AGGAAGCCTCAGCCTCGCACAGG No data
1036222245_1036222252 20 Left 1036222245 8:6930541-6930563 CCAGACACCGTGTTTTGAGGAAG No data
Right 1036222252 8:6930584-6930606 ATGAACTGAGGGCACCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036222245 Original CRISPR CTTCCTCAAAACACGGTGTC TGG (reversed) Intergenic
No off target data available for this crispr