ID: 1036223456

View in Genome Browser
Species Human (GRCh38)
Location 8:6939758-6939780
Sequence ATGTAGAGGCAAAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036223452_1036223456 -9 Left 1036223452 8:6939744-6939766 CCCAGTGGATATGGATGTAGAGG No data
Right 1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG No data
1036223454_1036223456 -10 Left 1036223454 8:6939745-6939767 CCAGTGGATATGGATGTAGAGGC No data
Right 1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG No data
1036223450_1036223456 0 Left 1036223450 8:6939735-6939757 CCTGAAGGGCCCAGTGGATATGG No data
Right 1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036223456 Original CRISPR ATGTAGAGGCAAAATGAGAA GGG Intergenic
No off target data available for this crispr