ID: 1036223817

View in Genome Browser
Species Human (GRCh38)
Location 8:6942125-6942147
Sequence TGCCCAGCACCACCCTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036223809_1036223817 17 Left 1036223809 8:6942085-6942107 CCAGTGGCTAAGTGAGGGTCCCC No data
Right 1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG No data
1036223810_1036223817 -2 Left 1036223810 8:6942104-6942126 CCCCTAACCCCCATGCTGAGTTG No data
Right 1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG No data
1036223812_1036223817 -4 Left 1036223812 8:6942106-6942128 CCTAACCCCCATGCTGAGTTGCC No data
Right 1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG No data
1036223814_1036223817 -10 Left 1036223814 8:6942112-6942134 CCCCATGCTGAGTTGCCCAGCAC No data
Right 1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG No data
1036223811_1036223817 -3 Left 1036223811 8:6942105-6942127 CCCTAACCCCCATGCTGAGTTGC No data
Right 1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG No data
1036223813_1036223817 -9 Left 1036223813 8:6942111-6942133 CCCCCATGCTGAGTTGCCCAGCA No data
Right 1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036223817 Original CRISPR TGCCCAGCACCACCCTGAAG TGG Intergenic
No off target data available for this crispr