ID: 1036236327

View in Genome Browser
Species Human (GRCh38)
Location 8:7042501-7042523
Sequence ATGTAGAGGCAAAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036236325_1036236327 -10 Left 1036236325 8:7042488-7042510 CCAGTGGATATGGATGTAGAGGC No data
Right 1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG No data
1036236323_1036236327 -9 Left 1036236323 8:7042487-7042509 CCCAGTGGATATGGATGTAGAGG No data
Right 1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG No data
1036236321_1036236327 0 Left 1036236321 8:7042478-7042500 CCTGAAGGGCCCAGTGGATATGG No data
Right 1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036236327 Original CRISPR ATGTAGAGGCAAAATGAGAA GGG Intergenic
No off target data available for this crispr