ID: 1036236504

View in Genome Browser
Species Human (GRCh38)
Location 8:7043570-7043592
Sequence GCGGGTGGACAAAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036236504_1036236515 -5 Left 1036236504 8:7043570-7043592 CCCTCAGCCCTTTGTCCACCCGC No data
Right 1036236515 8:7043588-7043610 CCCGCCTGTGGGGAGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036236504 Original CRISPR GCGGGTGGACAAAGGGCTGA GGG (reversed) Intergenic
No off target data available for this crispr