ID: 1036237914

View in Genome Browser
Species Human (GRCh38)
Location 8:7057423-7057445
Sequence TAAAAAAAAAATCTCAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036237914_1036237917 23 Left 1036237914 8:7057423-7057445 CCCTTTCTGAGATTTTTTTTTTA No data
Right 1036237917 8:7057469-7057491 CACAAGGAACAACATTCAAAAGG No data
1036237914_1036237916 7 Left 1036237914 8:7057423-7057445 CCCTTTCTGAGATTTTTTTTTTA No data
Right 1036237916 8:7057453-7057475 AAAATTGTAAATCATGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036237914 Original CRISPR TAAAAAAAAAATCTCAGAAA GGG (reversed) Intergenic
No off target data available for this crispr