ID: 1036237917

View in Genome Browser
Species Human (GRCh38)
Location 8:7057469-7057491
Sequence CACAAGGAACAACATTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036237914_1036237917 23 Left 1036237914 8:7057423-7057445 CCCTTTCTGAGATTTTTTTTTTA No data
Right 1036237917 8:7057469-7057491 CACAAGGAACAACATTCAAAAGG No data
1036237913_1036237917 24 Left 1036237913 8:7057422-7057444 CCCCTTTCTGAGATTTTTTTTTT No data
Right 1036237917 8:7057469-7057491 CACAAGGAACAACATTCAAAAGG No data
1036237915_1036237917 22 Left 1036237915 8:7057424-7057446 CCTTTCTGAGATTTTTTTTTTAG No data
Right 1036237917 8:7057469-7057491 CACAAGGAACAACATTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036237917 Original CRISPR CACAAGGAACAACATTCAAA AGG Intergenic
No off target data available for this crispr