ID: 1036239896

View in Genome Browser
Species Human (GRCh38)
Location 8:7072795-7072817
Sequence ACACGGCTGGGTCACCGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036239896_1036239900 0 Left 1036239896 8:7072795-7072817 CCAAAACGGTGACCCAGCCGTGT No data
Right 1036239900 8:7072818-7072840 GTTACCTGCCGACAGCATGATGG No data
1036239896_1036239904 9 Left 1036239896 8:7072795-7072817 CCAAAACGGTGACCCAGCCGTGT No data
Right 1036239904 8:7072827-7072849 CGACAGCATGATGGGAGTCAAGG No data
1036239896_1036239901 1 Left 1036239896 8:7072795-7072817 CCAAAACGGTGACCCAGCCGTGT No data
Right 1036239901 8:7072819-7072841 TTACCTGCCGACAGCATGATGGG No data
1036239896_1036239905 27 Left 1036239896 8:7072795-7072817 CCAAAACGGTGACCCAGCCGTGT No data
Right 1036239905 8:7072845-7072867 CAAGGTCCAGCCGTTCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036239896 Original CRISPR ACACGGCTGGGTCACCGTTT TGG (reversed) Intergenic
No off target data available for this crispr