ID: 1036240067

View in Genome Browser
Species Human (GRCh38)
Location 8:7073919-7073941
Sequence CCTAATATCCAGGGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036240067_1036240074 -7 Left 1036240067 8:7073919-7073941 CCTGTTTCCCCCTGGATATTAGG No data
Right 1036240074 8:7073935-7073957 TATTAGGAACAATGTCAGGAAGG No data
1036240067_1036240075 -6 Left 1036240067 8:7073919-7073941 CCTGTTTCCCCCTGGATATTAGG No data
Right 1036240075 8:7073936-7073958 ATTAGGAACAATGTCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036240067 Original CRISPR CCTAATATCCAGGGGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr