ID: 1036240146

View in Genome Browser
Species Human (GRCh38)
Location 8:7074373-7074395
Sequence CCTAATCTCCAGAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036240146_1036240150 -9 Left 1036240146 8:7074373-7074395 CCTCTCTCCCTCTGGAGATTAGG No data
Right 1036240150 8:7074387-7074409 GAGATTAGGAAGAGTATCACAGG No data
1036240146_1036240151 -8 Left 1036240146 8:7074373-7074395 CCTCTCTCCCTCTGGAGATTAGG No data
Right 1036240151 8:7074388-7074410 AGATTAGGAAGAGTATCACAGGG No data
1036240146_1036240153 18 Left 1036240146 8:7074373-7074395 CCTCTCTCCCTCTGGAGATTAGG No data
Right 1036240153 8:7074414-7074436 TGTATACCCCCTGCAGTAGTGGG No data
1036240146_1036240152 17 Left 1036240146 8:7074373-7074395 CCTCTCTCCCTCTGGAGATTAGG No data
Right 1036240152 8:7074413-7074435 GTGTATACCCCCTGCAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036240146 Original CRISPR CCTAATCTCCAGAGGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr