ID: 1036243114

View in Genome Browser
Species Human (GRCh38)
Location 8:7095377-7095399
Sequence GCTGTGGGTCAGACACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036243114_1036243117 -10 Left 1036243114 8:7095377-7095399 CCAGGGTGTGTCTGACCCACAGC No data
Right 1036243117 8:7095390-7095412 GACCCACAGCTCCTCCTGGAGGG No data
1036243114_1036243122 17 Left 1036243114 8:7095377-7095399 CCAGGGTGTGTCTGACCCACAGC No data
Right 1036243122 8:7095417-7095439 AAAAGTCTCTCCTAGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036243114 Original CRISPR GCTGTGGGTCAGACACACCC TGG (reversed) Intergenic
No off target data available for this crispr