ID: 1036243365

View in Genome Browser
Species Human (GRCh38)
Location 8:7096972-7096994
Sequence GTGTGTAAGTGGGAAATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036243360_1036243365 -10 Left 1036243360 8:7096959-7096981 CCTGAGGAATGCAGTGTGTAAGT No data
Right 1036243365 8:7096972-7096994 GTGTGTAAGTGGGAAATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036243365 Original CRISPR GTGTGTAAGTGGGAAATGGT GGG Intergenic
No off target data available for this crispr