ID: 1036244634

View in Genome Browser
Species Human (GRCh38)
Location 8:7105773-7105795
Sequence CATGGTGACCACAGTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036244634_1036244644 22 Left 1036244634 8:7105773-7105795 CCTTCAAGACTGTGGTCACCATG No data
Right 1036244644 8:7105818-7105840 CTGATTCTCATTTGTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036244634 Original CRISPR CATGGTGACCACAGTCTTGA AGG (reversed) Intergenic
No off target data available for this crispr