ID: 1036246974

View in Genome Browser
Species Human (GRCh38)
Location 8:7126256-7126278
Sequence TCCCATCGTTCCAAACCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036246974_1036246977 1 Left 1036246974 8:7126256-7126278 CCCCGAGGTTTGGAACGATGGGA No data
Right 1036246977 8:7126280-7126302 AGAGCTGCCATCTGTGTTTAAGG No data
1036246974_1036246980 10 Left 1036246974 8:7126256-7126278 CCCCGAGGTTTGGAACGATGGGA No data
Right 1036246980 8:7126289-7126311 ATCTGTGTTTAAGGTGAGAAGGG No data
1036246974_1036246984 18 Left 1036246974 8:7126256-7126278 CCCCGAGGTTTGGAACGATGGGA No data
Right 1036246984 8:7126297-7126319 TTAAGGTGAGAAGGGGGGAGTGG No data
1036246974_1036246983 13 Left 1036246974 8:7126256-7126278 CCCCGAGGTTTGGAACGATGGGA No data
Right 1036246983 8:7126292-7126314 TGTGTTTAAGGTGAGAAGGGGGG No data
1036246974_1036246979 9 Left 1036246974 8:7126256-7126278 CCCCGAGGTTTGGAACGATGGGA No data
Right 1036246979 8:7126288-7126310 CATCTGTGTTTAAGGTGAGAAGG No data
1036246974_1036246981 11 Left 1036246974 8:7126256-7126278 CCCCGAGGTTTGGAACGATGGGA No data
Right 1036246981 8:7126290-7126312 TCTGTGTTTAAGGTGAGAAGGGG No data
1036246974_1036246982 12 Left 1036246974 8:7126256-7126278 CCCCGAGGTTTGGAACGATGGGA No data
Right 1036246982 8:7126291-7126313 CTGTGTTTAAGGTGAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036246974 Original CRISPR TCCCATCGTTCCAAACCTCG GGG (reversed) Intergenic
No off target data available for this crispr