ID: 1036246976

View in Genome Browser
Species Human (GRCh38)
Location 8:7126258-7126280
Sequence TTTCCCATCGTTCCAAACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036246976_1036246981 9 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246981 8:7126290-7126312 TCTGTGTTTAAGGTGAGAAGGGG No data
1036246976_1036246982 10 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246982 8:7126291-7126313 CTGTGTTTAAGGTGAGAAGGGGG No data
1036246976_1036246985 30 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246985 8:7126311-7126333 GGGGAGTGGCTGTATATCAGAGG No data
1036246976_1036246980 8 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246980 8:7126289-7126311 ATCTGTGTTTAAGGTGAGAAGGG No data
1036246976_1036246984 16 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246984 8:7126297-7126319 TTAAGGTGAGAAGGGGGGAGTGG No data
1036246976_1036246977 -1 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246977 8:7126280-7126302 AGAGCTGCCATCTGTGTTTAAGG No data
1036246976_1036246979 7 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246979 8:7126288-7126310 CATCTGTGTTTAAGGTGAGAAGG No data
1036246976_1036246983 11 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246983 8:7126292-7126314 TGTGTTTAAGGTGAGAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036246976 Original CRISPR TTTCCCATCGTTCCAAACCT CGG (reversed) Intergenic
No off target data available for this crispr