ID: 1036246979

View in Genome Browser
Species Human (GRCh38)
Location 8:7126288-7126310
Sequence CATCTGTGTTTAAGGTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036246975_1036246979 8 Left 1036246975 8:7126257-7126279 CCCGAGGTTTGGAACGATGGGAA No data
Right 1036246979 8:7126288-7126310 CATCTGTGTTTAAGGTGAGAAGG No data
1036246976_1036246979 7 Left 1036246976 8:7126258-7126280 CCGAGGTTTGGAACGATGGGAAA No data
Right 1036246979 8:7126288-7126310 CATCTGTGTTTAAGGTGAGAAGG No data
1036246974_1036246979 9 Left 1036246974 8:7126256-7126278 CCCCGAGGTTTGGAACGATGGGA No data
Right 1036246979 8:7126288-7126310 CATCTGTGTTTAAGGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036246979 Original CRISPR CATCTGTGTTTAAGGTGAGA AGG Intergenic
No off target data available for this crispr