ID: 1036253816

View in Genome Browser
Species Human (GRCh38)
Location 8:7188078-7188100
Sequence CTGTGTTTAAGGTGAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036253816_1036253823 12 Left 1036253816 8:7188078-7188100 CCAACTTCTCACCTTAAACACAG No data
Right 1036253823 8:7188113-7188135 TCCCATCCTTCCAAACCTGGGGG No data
1036253816_1036253820 9 Left 1036253816 8:7188078-7188100 CCAACTTCTCACCTTAAACACAG No data
Right 1036253820 8:7188110-7188132 CCTTCCCATCCTTCCAAACCTGG No data
1036253816_1036253822 11 Left 1036253816 8:7188078-7188100 CCAACTTCTCACCTTAAACACAG No data
Right 1036253822 8:7188112-7188134 TTCCCATCCTTCCAAACCTGGGG No data
1036253816_1036253821 10 Left 1036253816 8:7188078-7188100 CCAACTTCTCACCTTAAACACAG No data
Right 1036253821 8:7188111-7188133 CTTCCCATCCTTCCAAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036253816 Original CRISPR CTGTGTTTAAGGTGAGAAGT TGG (reversed) Intergenic
No off target data available for this crispr