ID: 1036253823

View in Genome Browser
Species Human (GRCh38)
Location 8:7188113-7188135
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036253816_1036253823 12 Left 1036253816 8:7188078-7188100 CCAACTTCTCACCTTAAACACAG No data
Right 1036253823 8:7188113-7188135 TCCCATCCTTCCAAACCTGGGGG No data
1036253814_1036253823 14 Left 1036253814 8:7188076-7188098 CCCCAACTTCTCACCTTAAACAC No data
Right 1036253823 8:7188113-7188135 TCCCATCCTTCCAAACCTGGGGG No data
1036253818_1036253823 1 Left 1036253818 8:7188089-7188111 CCTTAAACACAGATGGCAGCTCC No data
Right 1036253823 8:7188113-7188135 TCCCATCCTTCCAAACCTGGGGG No data
1036253812_1036253823 23 Left 1036253812 8:7188067-7188089 CCAGCCACTCCCCAACTTCTCAC No data
Right 1036253823 8:7188113-7188135 TCCCATCCTTCCAAACCTGGGGG No data
1036253813_1036253823 19 Left 1036253813 8:7188071-7188093 CCACTCCCCAACTTCTCACCTTA No data
Right 1036253823 8:7188113-7188135 TCCCATCCTTCCAAACCTGGGGG No data
1036253815_1036253823 13 Left 1036253815 8:7188077-7188099 CCCAACTTCTCACCTTAAACACA No data
Right 1036253823 8:7188113-7188135 TCCCATCCTTCCAAACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036253823 Original CRISPR TCCCATCCTTCCAAACCTGG GGG Intergenic
No off target data available for this crispr