ID: 1036256481

View in Genome Browser
Species Human (GRCh38)
Location 8:7210589-7210611
Sequence TCTGCACCCTGGTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036256481_1036256487 0 Left 1036256481 8:7210589-7210611 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036256487 8:7210612-7210634 CTGGTGTGAGTAAAAGAAAGAGG No data
1036256481_1036256489 2 Left 1036256481 8:7210589-7210611 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036256489 8:7210614-7210636 GGTGTGAGTAAAAGAAAGAGGGG No data
1036256481_1036256488 1 Left 1036256481 8:7210589-7210611 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036256488 8:7210613-7210635 TGGTGTGAGTAAAAGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036256481 Original CRISPR TCTGCACCCTGGTGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr