ID: 1036258074

View in Genome Browser
Species Human (GRCh38)
Location 8:7221052-7221074
Sequence ACGTTGGCCCCTGAATCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036258074_1036258086 25 Left 1036258074 8:7221052-7221074 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036258086 8:7221100-7221122 GACAGCGCCCCGGGGATGCAAGG No data
1036258074_1036258078 -8 Left 1036258074 8:7221052-7221074 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036258078 8:7221067-7221089 GCCAACGTTTGCAGGACACCGGG No data
1036258074_1036258077 -9 Left 1036258074 8:7221052-7221074 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036258077 8:7221066-7221088 GGCCAACGTTTGCAGGACACCGG No data
1036258074_1036258080 2 Left 1036258074 8:7221052-7221074 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036258080 8:7221077-7221099 GCAGGACACCGGGAGCTCACAGG No data
1036258074_1036258083 15 Left 1036258074 8:7221052-7221074 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036258083 8:7221090-7221112 AGCTCACAGGGACAGCGCCCCGG No data
1036258074_1036258084 16 Left 1036258074 8:7221052-7221074 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036258084 8:7221091-7221113 GCTCACAGGGACAGCGCCCCGGG No data
1036258074_1036258081 3 Left 1036258074 8:7221052-7221074 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036258081 8:7221078-7221100 CAGGACACCGGGAGCTCACAGGG No data
1036258074_1036258085 17 Left 1036258074 8:7221052-7221074 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036258085 8:7221092-7221114 CTCACAGGGACAGCGCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036258074 Original CRISPR ACGTTGGCCCCTGAATCACC GGG (reversed) Intergenic
No off target data available for this crispr