ID: 1036259304

View in Genome Browser
Species Human (GRCh38)
Location 8:7227888-7227910
Sequence CCCGCCGCTGCCGGGCACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036259304_1036259309 2 Left 1036259304 8:7227888-7227910 CCTTCGTGCCCGGCAGCGGCGGG No data
Right 1036259309 8:7227913-7227935 CTCCCTGTCCTCGCAGTCCTCGG No data
1036259304_1036259310 3 Left 1036259304 8:7227888-7227910 CCTTCGTGCCCGGCAGCGGCGGG No data
Right 1036259310 8:7227914-7227936 TCCCTGTCCTCGCAGTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036259304 Original CRISPR CCCGCCGCTGCCGGGCACGA AGG (reversed) Intergenic