ID: 1036262044

View in Genome Browser
Species Human (GRCh38)
Location 8:7248817-7248839
Sequence AAGGGCCTATTGAATTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036262044_1036262051 9 Left 1036262044 8:7248817-7248839 CCCCCAGAATTCAATAGGCCCTT No data
Right 1036262051 8:7248849-7248871 TCACACTCCATGCACTTGAAGGG No data
1036262044_1036262050 8 Left 1036262044 8:7248817-7248839 CCCCCAGAATTCAATAGGCCCTT No data
Right 1036262050 8:7248848-7248870 ATCACACTCCATGCACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036262044 Original CRISPR AAGGGCCTATTGAATTCTGG GGG (reversed) Intergenic
No off target data available for this crispr