ID: 1036262209

View in Genome Browser
Species Human (GRCh38)
Location 8:7249893-7249915
Sequence TACCCACAGTCCTCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036262203_1036262209 30 Left 1036262203 8:7249840-7249862 CCAAGTAACGTACCTGCTGTCGG No data
Right 1036262209 8:7249893-7249915 TACCCACAGTCCTCCAGGTGCGG No data
1036262205_1036262209 18 Left 1036262205 8:7249852-7249874 CCTGCTGTCGGCAGATCTGAGCT 0: 27
1: 52
2: 35
3: 43
4: 215
Right 1036262209 8:7249893-7249915 TACCCACAGTCCTCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036262209 Original CRISPR TACCCACAGTCCTCCAGGTG CGG Intergenic
No off target data available for this crispr