ID: 1036274594

View in Genome Browser
Species Human (GRCh38)
Location 8:7339328-7339350
Sequence ACACCGTGAAACAGGTAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036274594_1036274598 0 Left 1036274594 8:7339328-7339350 CCGACTTACCTGTTTCACGGTGT No data
Right 1036274598 8:7339351-7339373 CCACTTCCATTGCGTGGAAACGG No data
1036274594_1036274601 21 Left 1036274594 8:7339328-7339350 CCGACTTACCTGTTTCACGGTGT No data
Right 1036274601 8:7339372-7339394 GGAAAATTTTCCCACTGGCACGG No data
1036274594_1036274600 16 Left 1036274594 8:7339328-7339350 CCGACTTACCTGTTTCACGGTGT No data
Right 1036274600 8:7339367-7339389 GAAACGGAAAATTTTCCCACTGG No data
1036274594_1036274596 -6 Left 1036274594 8:7339328-7339350 CCGACTTACCTGTTTCACGGTGT No data
Right 1036274596 8:7339345-7339367 CGGTGTCCACTTCCATTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036274594 Original CRISPR ACACCGTGAAACAGGTAAGT CGG (reversed) Intergenic