ID: 1036274595

View in Genome Browser
Species Human (GRCh38)
Location 8:7339336-7339358
Sequence GGAAGTGGACACCGTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036274595_1036274600 8 Left 1036274595 8:7339336-7339358 CCTGTTTCACGGTGTCCACTTCC No data
Right 1036274600 8:7339367-7339389 GAAACGGAAAATTTTCCCACTGG No data
1036274595_1036274604 24 Left 1036274595 8:7339336-7339358 CCTGTTTCACGGTGTCCACTTCC No data
Right 1036274604 8:7339383-7339405 CCACTGGCACGGAAGTCATTTGG No data
1036274595_1036274598 -8 Left 1036274595 8:7339336-7339358 CCTGTTTCACGGTGTCCACTTCC No data
Right 1036274598 8:7339351-7339373 CCACTTCCATTGCGTGGAAACGG No data
1036274595_1036274601 13 Left 1036274595 8:7339336-7339358 CCTGTTTCACGGTGTCCACTTCC No data
Right 1036274601 8:7339372-7339394 GGAAAATTTTCCCACTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036274595 Original CRISPR GGAAGTGGACACCGTGAAAC AGG (reversed) Intergenic