ID: 1036274597

View in Genome Browser
Species Human (GRCh38)
Location 8:7339351-7339373
Sequence CCGTTTCCACGCAATGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036274597_1036274604 9 Left 1036274597 8:7339351-7339373 CCACTTCCATTGCGTGGAAACGG No data
Right 1036274604 8:7339383-7339405 CCACTGGCACGGAAGTCATTTGG No data
1036274597_1036274600 -7 Left 1036274597 8:7339351-7339373 CCACTTCCATTGCGTGGAAACGG No data
Right 1036274600 8:7339367-7339389 GAAACGGAAAATTTTCCCACTGG No data
1036274597_1036274601 -2 Left 1036274597 8:7339351-7339373 CCACTTCCATTGCGTGGAAACGG No data
Right 1036274601 8:7339372-7339394 GGAAAATTTTCCCACTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036274597 Original CRISPR CCGTTTCCACGCAATGGAAG TGG (reversed) Intergenic
No off target data available for this crispr