ID: 1036274600

View in Genome Browser
Species Human (GRCh38)
Location 8:7339367-7339389
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036274597_1036274600 -7 Left 1036274597 8:7339351-7339373 CCACTTCCATTGCGTGGAAACGG No data
Right 1036274600 8:7339367-7339389 GAAACGGAAAATTTTCCCACTGG No data
1036274594_1036274600 16 Left 1036274594 8:7339328-7339350 CCGACTTACCTGTTTCACGGTGT No data
Right 1036274600 8:7339367-7339389 GAAACGGAAAATTTTCCCACTGG No data
1036274595_1036274600 8 Left 1036274595 8:7339336-7339358 CCTGTTTCACGGTGTCCACTTCC No data
Right 1036274600 8:7339367-7339389 GAAACGGAAAATTTTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036274600 Original CRISPR GAAACGGAAAATTTTCCCAC TGG Intergenic