ID: 1036274601

View in Genome Browser
Species Human (GRCh38)
Location 8:7339372-7339394
Sequence GGAAAATTTTCCCACTGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036274594_1036274601 21 Left 1036274594 8:7339328-7339350 CCGACTTACCTGTTTCACGGTGT No data
Right 1036274601 8:7339372-7339394 GGAAAATTTTCCCACTGGCACGG No data
1036274597_1036274601 -2 Left 1036274597 8:7339351-7339373 CCACTTCCATTGCGTGGAAACGG No data
Right 1036274601 8:7339372-7339394 GGAAAATTTTCCCACTGGCACGG No data
1036274595_1036274601 13 Left 1036274595 8:7339336-7339358 CCTGTTTCACGGTGTCCACTTCC No data
Right 1036274601 8:7339372-7339394 GGAAAATTTTCCCACTGGCACGG No data
1036274599_1036274601 -8 Left 1036274599 8:7339357-7339379 CCATTGCGTGGAAACGGAAAATT No data
Right 1036274601 8:7339372-7339394 GGAAAATTTTCCCACTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036274601 Original CRISPR GGAAAATTTTCCCACTGGCA CGG Intergenic