ID: 1036274604

View in Genome Browser
Species Human (GRCh38)
Location 8:7339383-7339405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036274595_1036274604 24 Left 1036274595 8:7339336-7339358 CCTGTTTCACGGTGTCCACTTCC No data
Right 1036274604 8:7339383-7339405 CCACTGGCACGGAAGTCATTTGG No data
1036274599_1036274604 3 Left 1036274599 8:7339357-7339379 CCATTGCGTGGAAACGGAAAATT No data
Right 1036274604 8:7339383-7339405 CCACTGGCACGGAAGTCATTTGG No data
1036274597_1036274604 9 Left 1036274597 8:7339351-7339373 CCACTTCCATTGCGTGGAAACGG No data
Right 1036274604 8:7339383-7339405 CCACTGGCACGGAAGTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036274604 Original CRISPR CCACTGGCACGGAAGTCATT TGG Intergenic