ID: 1036278060

View in Genome Browser
Species Human (GRCh38)
Location 8:7373748-7373770
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 4, 1: 0, 2: 3, 3: 22, 4: 238}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036278054_1036278060 18 Left 1036278054 8:7373707-7373729 CCATCCCTGGCTGTCCCTCTTCC 0: 2
1: 4
2: 12
3: 123
4: 1095
Right 1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG 0: 4
1: 0
2: 3
3: 22
4: 238
1036278057_1036278060 4 Left 1036278057 8:7373721-7373743 CCCTCTTCCTTCTCAGCATCTAG 0: 6
1: 0
2: 7
3: 36
4: 515
Right 1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG 0: 4
1: 0
2: 3
3: 22
4: 238
1036278055_1036278060 14 Left 1036278055 8:7373711-7373733 CCCTGGCTGTCCCTCTTCCTTCT 0: 2
1: 4
2: 5
3: 86
4: 790
Right 1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG 0: 4
1: 0
2: 3
3: 22
4: 238
1036278059_1036278060 -3 Left 1036278059 8:7373728-7373750 CCTTCTCAGCATCTAGTCTTGTA 0: 6
1: 0
2: 0
3: 19
4: 156
Right 1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG 0: 4
1: 0
2: 3
3: 22
4: 238
1036278058_1036278060 3 Left 1036278058 8:7373722-7373744 CCTCTTCCTTCTCAGCATCTAGT 0: 6
1: 0
2: 9
3: 76
4: 675
Right 1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG 0: 4
1: 0
2: 3
3: 22
4: 238
1036278056_1036278060 13 Left 1036278056 8:7373712-7373734 CCTGGCTGTCCCTCTTCCTTCTC 0: 2
1: 4
2: 3
3: 80
4: 733
Right 1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG 0: 4
1: 0
2: 3
3: 22
4: 238
1036278053_1036278060 24 Left 1036278053 8:7373701-7373723 CCATCTCCATCCCTGGCTGTCCC 0: 2
1: 4
2: 12
3: 94
4: 850
Right 1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG 0: 4
1: 0
2: 3
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902035236 1:13453181-13453203 TCAATCTAGAATTTAAACCCAGG - Intergenic
904414962 1:30355034-30355056 GCAATTTAGGATATAAACACAGG + Intergenic
905559725 1:38916962-38916984 GAAATGTAGGATATAAACAATGG + Intronic
906931055 1:50169918-50169940 ATAATGTAGAAGGAAAACACAGG - Intronic
908303517 1:62786471-62786493 CTAATGTGGAATTTAAATAGTGG + Intronic
909081435 1:71117290-71117312 GCAATGTATAATATAAACTCTGG - Intergenic
909492829 1:76244653-76244675 GTAATGTTGAATTTTATCAATGG + Intronic
909518110 1:76534758-76534780 GCCATGTACAATTTAGACACTGG - Intronic
910528102 1:88204169-88204191 GGAATGTAGAGTCCAAACACTGG - Intergenic
913365941 1:118038895-118038917 GTAATGTAAACTTTAGACTCTGG + Intronic
914372672 1:147043261-147043283 GTAAGGTAGAATTCAAACATGGG + Intergenic
914576829 1:148979531-148979553 GTAAGGTGGAATTCAAACATGGG - Intronic
916308756 1:163370631-163370653 GTACTGTAGTATTTGAAAACAGG + Intergenic
917107566 1:171508622-171508644 GTAATACACAATTTAACCACAGG - Intronic
917450083 1:175140778-175140800 GTAATTCAGAATTTAAAAGCGGG - Intronic
918162283 1:181912525-181912547 ATAATGTAAAATTAAAACTCTGG + Intergenic
919678843 1:200412952-200412974 GTAATGAAAAAATTAAACTCAGG + Intergenic
920134713 1:203760394-203760416 GTAATTTAGAACTTGAACTCAGG + Intergenic
920915477 1:210254699-210254721 ATAAAGTAGAAATTAAACATGGG + Intergenic
1064357296 10:14631423-14631445 GTGCTGTAGAATTTATACACTGG - Intronic
1065093605 10:22259875-22259897 GAAAAGTAGATTTTAAAAACAGG - Intergenic
1066382871 10:34916535-34916557 GAAATCAAGAAATTAAACACAGG - Intergenic
1068095834 10:52489821-52489843 GTAATTTTGAAATTAACCACAGG - Intergenic
1068800544 10:61135413-61135435 GTAATCTAGAAAGTAAACATGGG - Intergenic
1069299172 10:66885079-66885101 GTAATTTACAATTTACTCACTGG + Intronic
1070490980 10:76976309-76976331 GTTATGTAGAAGTTAATCACAGG + Intronic
1071419244 10:85473795-85473817 CCACTGTAGAATTTAAACAAAGG - Intergenic
1073421345 10:103426024-103426046 TTAATCTAGAATTCAAACCCGGG - Intronic
1074097730 10:110328815-110328837 ACAATGTAGAATGTAAACCCAGG + Intergenic
1074269869 10:111943540-111943562 ATAAAGTAGAATTTAAAAATAGG + Intergenic
1074330774 10:112506544-112506566 ATAATGTAGACGTTACACACTGG + Intronic
1081750825 11:45510007-45510029 GTAATGGAGGATTTAAATCCAGG - Intergenic
1083007223 11:59358009-59358031 TTAATGAAGAATTTTAACAAAGG + Intergenic
1084078170 11:66798718-66798740 AAGATTTAGAATTTAAACACAGG + Intronic
1084839538 11:71833811-71833833 GTAATGTAGAATTTAAACACAGG + Intronic
1087319626 11:96642491-96642513 GTAATGCCTTATTTAAACACAGG + Intergenic
1088242322 11:107785189-107785211 AGAATGTACAATTGAAACACTGG + Intergenic
1088910143 11:114184577-114184599 GTAAAGGTGAATTCAAACACAGG - Intronic
1089043558 11:115478058-115478080 TTAATGTAGAATTTGAACAAAGG - Intronic
1092747663 12:11688886-11688908 TTAATCTAGGATTTAAATACAGG + Intronic
1095583175 12:43823326-43823348 GCAAAGTAGAATTTGAACCCAGG + Intergenic
1095876368 12:47083297-47083319 GTCAGGTGGAATTTATACACTGG + Intronic
1097655713 12:62359970-62359992 ATAATGCAAAATTTAAAAACTGG - Intronic
1098195744 12:68000148-68000170 GTAAAGTAAAATATTAACACTGG + Intergenic
1104401995 12:128483915-128483937 GCAATGTAGAGTGTAATCACTGG - Intronic
1106439448 13:29752761-29752783 CTAATGTAGAGTTTAAGAACTGG + Intergenic
1106501568 13:30334244-30334266 CTAATATATATTTTAAACACTGG - Intergenic
1106724986 13:32474946-32474968 GTTATGTATAATATTAACACAGG - Intronic
1109451135 13:62515787-62515809 GTAATTTAGACTTTGAACATGGG - Intergenic
1109645892 13:65255084-65255106 TTAATTTAGAATTAAAACATTGG + Intergenic
1112357222 13:98683878-98683900 GTTATCCATAATTTAAACACAGG + Exonic
1112687168 13:101843189-101843211 TTAATGTATCATTTTAACACAGG + Intronic
1112900375 13:104351006-104351028 GTAATGTTGAATTTTATCTCAGG - Intergenic
1113237774 13:108300212-108300234 GTACTGTAAAAATTAATCACAGG - Intronic
1115069744 14:29306556-29306578 GAATTTTAGAATTTTAACACTGG - Intergenic
1115351212 14:32397659-32397681 GTAATGCAGAATTAACTCACTGG + Intronic
1115678951 14:35714611-35714633 GAAGGGTAGAATTTAAATACAGG - Intronic
1115720353 14:36154143-36154165 TTTATGTAAAATTAAAACACAGG + Intergenic
1116756036 14:48949186-48949208 GCAAAGTAGAATTTGAACCCAGG - Intergenic
1118679702 14:68227371-68227393 GGAAAGTAGGATTTAAACCCAGG - Intronic
1118899046 14:69971324-69971346 GTACTGTAGAATGTAACCAGGGG - Intronic
1119270819 14:73302912-73302934 CAAATGTAGAATTTACATACAGG + Intronic
1120046133 14:79808442-79808464 GTAATGTAGAATTGCAAGATTGG - Intronic
1120508402 14:85381728-85381750 GTAGTGGGGGATTTAAACACAGG - Intergenic
1120599134 14:86479159-86479181 GTAATGTAGGATATTAATACTGG - Intergenic
1125408148 15:39375642-39375664 TTAATGTAAAGTTTAAAAACAGG + Intergenic
1126418823 15:48449532-48449554 ATAATTTAGAACTTAAAGACTGG - Intronic
1127017985 15:54710136-54710158 GTCATCCAGCATTTAAACACAGG + Intergenic
1130813927 15:87410836-87410858 GTAATGCAGTATTGAACCACAGG - Intergenic
1132078127 15:98840088-98840110 GTAATGTGCAATTAAAACAAGGG - Intronic
1136681651 16:31969132-31969154 GTAAAGTATAATTTAAAGAAAGG + Intergenic
1136781958 16:32910634-32910656 GTAAAGTATAATTTAAAGAAAGG + Intergenic
1136887834 16:33943218-33943240 GTAAAGTATAATTTAAAGAAAGG - Intergenic
1137796873 16:51228485-51228507 GTGATGTAGAATTTATTCTCAGG - Intergenic
1138974345 16:62185757-62185779 CTTATGTAGAATTTAAAAAATGG + Intergenic
1140806411 16:78536255-78536277 GTCATGTAGATTTTAACCAAAGG + Intronic
1142214508 16:88824058-88824080 GTAATGGAGAGTCTAAAGACTGG - Intronic
1203084615 16_KI270728v1_random:1174620-1174642 GTAAAGTATAATTTAAAGAAAGG + Intergenic
1142800320 17:2340883-2340905 TTTCTGTAGAAATTAAACACTGG - Intronic
1144636069 17:16909885-16909907 GTAACAAAGAAATTAAACACAGG - Intergenic
1145969050 17:28944480-28944502 GTAATGTTCAATTTTAACTCAGG - Intronic
1149857967 17:60101152-60101174 GTACTAATGAATTTAAACACTGG - Intergenic
1150846990 17:68669165-68669187 GTCATCTAGGCTTTAAACACTGG + Intergenic
1153084264 18:1265389-1265411 ATAATGTAGAATTAAAACAAAGG - Intergenic
1154293730 18:13132152-13132174 TAAATGTAGGATTTAAACAAAGG - Intergenic
1156878571 18:42047179-42047201 GTAATTTATAATTTAAAAATGGG + Intronic
1156996982 18:43480525-43480547 ATAATATAGAATTTAAAAACAGG - Intergenic
1163912542 19:20209972-20209994 TTAATGGAAAATTTAAAAACTGG + Intergenic
1164626310 19:29730822-29730844 ATTATGTGGAATTTCAACACTGG + Intergenic
927371500 2:22360865-22360887 GAAATCTAGAGTTTTAACACTGG + Intergenic
928354501 2:30597857-30597879 GGAATGTTGAATTTTATCACAGG + Intronic
929204138 2:39271094-39271116 GTAAAGTTGAATTTAAATCCTGG - Intronic
929652677 2:43696975-43696997 GTAAAACAGAATTTAAACATTGG + Intronic
931360526 2:61574187-61574209 GTAATCTTGCATTTAAACATTGG - Intergenic
932116444 2:69054259-69054281 GTAATTAAGAATATGAACACTGG - Intronic
932586492 2:73033054-73033076 GAGATCTAGAATTTAAACCCAGG - Intronic
933105397 2:78318340-78318362 GTAATGCAAAACTTAAACAAGGG + Intergenic
935442620 2:103119308-103119330 TTTTTGGAGAATTTAAACACAGG - Intergenic
935903085 2:107813635-107813657 CTAATGTAGATCTTAAGCACGGG - Intergenic
936875988 2:117190264-117190286 TTAATGTGGAATTTGAACCCAGG + Intergenic
937722045 2:125111299-125111321 GTAATATATTATTTAAACACAGG + Intergenic
939328010 2:140720300-140720322 GTAATGTATAATATAATTACAGG + Intronic
939850598 2:147299797-147299819 GGGAAGTAGAATTTAAGCACTGG - Intergenic
939998430 2:148942504-148942526 TTAATGTAGAATTCAAGCCCTGG + Intronic
940022462 2:149169726-149169748 GAAATGCAGACTTTAAATACAGG + Intronic
940092871 2:149941119-149941141 GGAATGTAGAATACAAAGACAGG - Intergenic
940155651 2:150653524-150653546 GGAATGAAGAATTTCAACAGAGG - Intergenic
940451757 2:153846267-153846289 TATATGTAGAATTTAAACAGAGG + Intergenic
941822158 2:169854429-169854451 GTAAAGTGGAACTTTAACACTGG + Intronic
943049400 2:182896813-182896835 ATAATGAAAAATTTAAAAACTGG + Intergenic
944112304 2:196145656-196145678 CTAATGTAGGATTAGAACACAGG + Intronic
944871046 2:203911958-203911980 AAGATCTAGAATTTAAACACAGG - Intergenic
946496130 2:220197350-220197372 GTAATGAGCACTTTAAACACGGG - Intergenic
947397968 2:229705287-229705309 GTCCTTTAGAATTTCAACACTGG - Intronic
948077751 2:235179600-235179622 GTACTGTAAAATATAATCACAGG + Intergenic
1169703099 20:8471068-8471090 ATAATGTACAATTTACACATTGG + Intronic
1169727657 20:8753482-8753504 GTAATGAGGACATTAAACACTGG - Intronic
1172674907 20:36662014-36662036 AAAAGGTAGAATTTAAAAACTGG + Intronic
1173885542 20:46454938-46454960 GTGATGTTGAATTTAAAAAAGGG - Intergenic
1174397415 20:50256385-50256407 GTGAAGTAGAATTCAAACCCAGG + Intergenic
1174527266 20:51183337-51183359 GTAATCTAATATTTTAACACTGG + Intergenic
1177481929 21:21701197-21701219 GTAATGAAGATTTTATACAAAGG - Intergenic
1177712637 21:24798711-24798733 GTAATGTAAAAGTTAAAAATTGG + Intergenic
1178027014 21:28479526-28479548 GTAATGTAGAAATAAAATACTGG - Intergenic
1178632072 21:34270463-34270485 ATCATGTAGTATTTACACACAGG - Intergenic
1180024774 21:45154744-45154766 ATAATGTACCATTTAAATACTGG + Intronic
1184052102 22:42014748-42014770 GAAATGAACAATTTAATCACTGG - Intronic
1185249953 22:49795999-49796021 GAAATTTAGAAAATAAACACAGG - Intronic
949334572 3:2960675-2960697 TTAATGTATAATTTAAAGTCAGG - Intronic
949925924 3:9041578-9041600 GCAATGAAGAATTTAAACTGAGG - Intronic
951211894 3:19984296-19984318 GGAATGTACATTTTAAATACAGG - Exonic
951527086 3:23663898-23663920 GTATAATAGAATTTCAACACTGG + Intergenic
952464707 3:33570558-33570580 GTAATTTAGAAATTAATCTCTGG - Intronic
955853055 3:63241686-63241708 TTTATGAAGAATTTAAACTCAGG + Intronic
956302169 3:67783968-67783990 GTCATGTGGAATTTTAACAAAGG - Intergenic
957378072 3:79386318-79386340 GTAATGGGGAATTTAAAAACGGG + Intronic
959133388 3:102386379-102386401 GAAATGTAGAATTTATAGAATGG - Intronic
959569799 3:107871036-107871058 GTAATTGTGAATTTAAACAGTGG + Intergenic
959574778 3:107922852-107922874 GCAGTGTAGAATTCAAGCACTGG - Intergenic
965130894 3:164699380-164699402 TGAATGTATAATTTAAACTCTGG + Intergenic
966669864 3:182515063-182515085 GAGAGGTAGAATTTAATCACAGG + Intergenic
966940734 3:184745176-184745198 GAAATGTAGAATATGAACAAGGG - Intergenic
967157635 3:186708122-186708144 GAAAAGTAGAATTTAAAAAACGG - Intergenic
968881754 4:3303886-3303908 GTAAAGAAGAAATTAAAGACTGG - Intronic
969780625 4:9399815-9399837 GTAATGTAGAATTTAAACACAGG + Intergenic
970111515 4:12642978-12643000 GAAATGTCCAATTTTAACACTGG + Intergenic
970336728 4:15053994-15054016 ATAAATTAGAATATAAACACTGG - Intronic
971593008 4:28493156-28493178 GTAATGTTGAATTTTATCAAAGG - Intergenic
971750173 4:30636821-30636843 ATAATGTAAAATTTTTACACAGG - Intergenic
972683999 4:41334120-41334142 GTAATGTAGAATTTACGTAGTGG + Intergenic
974754084 4:66181025-66181047 GTATTGTAGAATATTAACAGTGG + Intergenic
974838076 4:67274448-67274470 GAAATGAAAAATTTAAAAACAGG + Intergenic
976158081 4:82169280-82169302 GTAATGTAGTATATATAGACAGG + Intergenic
977473130 4:97468046-97468068 TTAAAGTATAATTTAATCACTGG - Intronic
977661742 4:99596217-99596239 GTAATGAATAATTTAAAAACTGG + Intronic
978468906 4:109039839-109039861 GGAATATAGAATTTAGAGACAGG - Intronic
979312845 4:119224317-119224339 TTAATGTAGCATTTATACATCGG - Intronic
979362893 4:119785061-119785083 TTAATGCAGACTTTAAAAACAGG - Intergenic
979777268 4:124605732-124605754 GTAAGGTAGAAGGTAAACAAAGG + Intergenic
979903778 4:126257594-126257616 AAAATGTAGAATGTAAACACAGG + Intergenic
980097158 4:128503231-128503253 GTAATGTAAAATGTTAACACTGG - Intergenic
980186506 4:129468364-129468386 GTAATGTAATAGTTAAAGACAGG - Intergenic
980517332 4:133879518-133879540 GTAATGTTTAATTTATAAACTGG + Intergenic
980814399 4:137924222-137924244 GTAAGGAAGAATGAAAACACAGG - Intergenic
982167658 4:152629359-152629381 GTCATTTAGAATTCAAACATCGG + Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
983402755 4:167286172-167286194 GCAATGTTGAATTTTATCACAGG + Intergenic
984092729 4:175394594-175394616 GAACTGTAGATTCTAAACACTGG + Intergenic
984225622 4:177031574-177031596 GTAATGAAGCCTTTAAGCACAGG + Intergenic
987226152 5:15843779-15843801 TTAATGAAGAATCTACACACAGG + Intronic
987292639 5:16523137-16523159 GTAATGTAAAATATTAACAGGGG - Intronic
987491874 5:18591525-18591547 TAAATGTAGAATTTAGTCACTGG + Intergenic
988172248 5:27673253-27673275 GACATGATGAATTTAAACACAGG - Intergenic
989075100 5:37556752-37556774 ACAATGCAGAATTTAAACATAGG + Intronic
990297583 5:54418528-54418550 GTAGTGTAGATATTAAACATAGG + Intergenic
991478972 5:67056636-67056658 TTAATATAGAATTTAATCAGAGG + Intronic
991613751 5:68474942-68474964 GATGTGTAGAAGTTAAACACTGG + Intergenic
992878195 5:81078645-81078667 ATAATTTTGAATTTTAACACAGG + Intronic
992924096 5:81563021-81563043 GTTTTGTAGAAATCAAACACTGG + Intronic
993089056 5:83401105-83401127 GAAAGGCAGAATTTAAACTCAGG + Intergenic
993173277 5:84449013-84449035 GTAAAGTAGAATATAAATAATGG - Intergenic
993324642 5:86517849-86517871 GAAATATAGTATTTACACACAGG + Intergenic
993643562 5:90435502-90435524 GTAATATAGAATTTAGAAGCTGG - Intergenic
993668066 5:90725777-90725799 GTAAAGTAGAATGTAAAGACTGG + Intronic
993793976 5:92243721-92243743 GTAAAGTAGAAATTAACGACTGG + Intergenic
994152098 5:96459338-96459360 GTAATGTAGATCTCAAACTCAGG + Intergenic
994553337 5:101263610-101263632 GTAATGTAAAATGTTAACATAGG + Intergenic
995003371 5:107161716-107161738 GTAATGTTGAATTTTATCAAAGG - Intergenic
995009190 5:107239027-107239049 TTAATGAAGATTTTAAACAAAGG - Intergenic
995285152 5:110379828-110379850 GTAATGAAAATTTTAAATACTGG - Intronic
995400088 5:111731239-111731261 GAAATGAAGTAATTAAACACTGG + Intronic
995954373 5:117757540-117757562 GTAATGTGGACCTTAATCACAGG - Intergenic
996262986 5:121497032-121497054 GAAATGTAGAACATAAATACAGG - Intergenic
997806715 5:136925069-136925091 GTAAGCTAGGATTTAAACCCAGG - Intergenic
999983717 5:156983126-156983148 GTAAAGGAGAAAATAAACACTGG + Intergenic
1004438881 6:15627314-15627336 GTAATGTACAATGAAAACATTGG + Intronic
1005423873 6:25680790-25680812 GTATTACAGAATTAAAACACAGG - Intronic
1005829878 6:29662163-29662185 ATAATGAAGAATTTAAAGAAAGG - Intronic
1006996588 6:38266948-38266970 GTGATGCCAAATTTAAACACGGG - Intronic
1009937706 6:70252980-70253002 TTTATGTAGAATATAAGCACTGG + Intronic
1011580545 6:88859264-88859286 ATAATGCAGAATTCAAACCCAGG + Intronic
1012742837 6:103041808-103041830 GTAAAGTAGAGTTTAAATATGGG - Intergenic
1013948307 6:115749343-115749365 GGAATGTAGAAGTTCAACAACGG - Intergenic
1014367195 6:120559369-120559391 GGAATGTTGAATTTTAACAAAGG + Intergenic
1015413852 6:132925978-132926000 GTAGTGTAGTGGTTAAACACGGG + Intergenic
1015436142 6:133191348-133191370 GGATTGTTAAATTTAAACACTGG + Intergenic
1016438518 6:144061586-144061608 ATAATGTGGAAGTTAAACATGGG - Intronic
1017156696 6:151328771-151328793 GAATTGTAAAATTTAAACACAGG - Intronic
1018267885 6:162044604-162044626 GGAATGTTGATTTTATACACTGG + Intronic
1021534331 7:21685942-21685964 GAAATGTAGTCTCTAAACACTGG + Intronic
1024701053 7:51904541-51904563 TTAATGTAGCAATTATACACGGG - Intergenic
1024717529 7:52096902-52096924 CTAATGTAAACTATAAACACTGG + Intergenic
1025706276 7:63867464-63867486 CTAATGTAGTATTTAAAGACAGG + Intergenic
1027380276 7:77600981-77601003 GTATTGTTGCATTAAAACACAGG + Intronic
1027459990 7:78440334-78440356 GTGCTGTAGAATTTGAACTCGGG + Intronic
1029863111 7:103596850-103596872 GTAATGTAGACATTAACCAAAGG - Intronic
1030342541 7:108396808-108396830 TTTAACTAGAATTTAAACACAGG + Intronic
1030405557 7:109107754-109107776 GTAATATACAATTAAAATACTGG + Intergenic
1030534741 7:110752100-110752122 TTAATATAGAATTTTAACCCAGG + Intronic
1030953790 7:115825373-115825395 CTAATGTAGAATATAAACTCAGG - Intergenic
1031026223 7:116683041-116683063 GTGAGGGAGATTTTAAACACGGG - Intronic
1033431927 7:141297237-141297259 TTAAAGTAGAAGTTAAACAAAGG + Intronic
1035190881 7:157167400-157167422 GTAAAGCAGAATTCAAACTCAGG - Intronic
1035893209 8:3368704-3368726 GAAATGTAGATTATAAACACTGG - Intronic
1036124965 8:6053963-6053985 GTAAAGTAGGATTCAAACTCAGG - Intergenic
1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG + Intronic
1036343463 8:7938144-7938166 GTAATGTAGAATTTAAACACAGG - Intronic
1036838804 8:12098908-12098930 GTCTTGTAGAATTTAAACACAGG - Intergenic
1036860592 8:12345151-12345173 GTCTTGTAGAATTTAAACACAGG - Intergenic
1037166880 8:15841045-15841067 CTAATGGAAAATATAAACACAGG - Intergenic
1037653012 8:20857352-20857374 ATAATGTAGAATATAAAAAGTGG + Intergenic
1038179861 8:25217372-25217394 GTAATGAACAACTTAAAAACGGG + Intronic
1038330304 8:26603042-26603064 GTATTTTAGAATTTAGACTCCGG + Intronic
1039371841 8:36992611-36992633 GGAATGTAGAATTTCCAAACAGG - Intergenic
1040350067 8:46556639-46556661 GTAATGTAGAATTTAATACCTGG + Intergenic
1040734261 8:50486928-50486950 GTAATCCAGCATATAAACACAGG - Intronic
1044479154 8:92664970-92664992 GTGATGAAGAATTAATACACTGG + Intergenic
1045014873 8:97992410-97992432 ATAATGTAGCTTTAAAACACTGG - Intronic
1046445735 8:114315801-114315823 ATAATGTAGAATTAAAACCTAGG + Intergenic
1047157477 8:122336715-122336737 ACAAGATAGAATTTAAACACTGG + Intergenic
1050209512 9:3237781-3237803 GAAATATAGAATTTAAATACAGG + Intronic
1055292602 9:74798729-74798751 ATAAAGTAGCATCTAAACACTGG + Intronic
1056487584 9:87074662-87074684 GTACTGCAGTATTTAAATACAGG + Intergenic
1057079713 9:92163844-92163866 GTAATGTAAGATGTAAACAATGG - Intergenic
1057253367 9:93522252-93522274 GTTATATAGAATTCAAACACTGG + Intronic
1057625511 9:96672975-96672997 GTTATGTAAAATGTGAACACTGG + Intergenic
1058274263 9:103020940-103020962 TTGATGGAGAATTTAAATACTGG - Intergenic
1059371320 9:113840690-113840712 GTATTTTAAAATTTAAAGACTGG + Intergenic
1059764469 9:117370873-117370895 ATAATGTAGAATTTAAGCTTAGG - Intronic
1186319501 X:8408944-8408966 GTTATGTAGAATTTGAACTAAGG - Intergenic
1186520059 X:10197943-10197965 GTAATTCAGAATGTAAGCACTGG - Exonic
1188031754 X:25271735-25271757 GTGATTTAGAATTTAGACCCTGG + Intergenic
1188485782 X:30680472-30680494 GTAGTGTAGACTTAAAACACGGG + Intronic
1190416723 X:50187481-50187503 TTAAGGTAGAACTTTAACACGGG + Intergenic
1190757858 X:53416349-53416371 GTAAAGTAAAATTTAAAAATAGG + Intronic
1191087068 X:56580307-56580329 GTAAGGTAGACTTTAAGAACAGG - Intergenic
1191201790 X:57791033-57791055 ATAATGTAAAACTTAAACTCTGG + Intergenic
1191766928 X:64707923-64707945 GTAATAGCAAATTTAAACACAGG - Intergenic
1192734605 X:73837613-73837635 CTAATGTAAAATGTTAACACTGG + Intergenic
1193946713 X:87745960-87745982 GTAATCTGGAATTTAAATAGAGG + Intergenic
1194529460 X:95026917-95026939 GTCAAGAAGAATTTAAAGACAGG - Intergenic
1195235463 X:102892829-102892851 GTGATGTTGAAATTAATCACTGG + Intergenic
1197328508 X:125123918-125123940 GTAATGTAGAAGTTAAAAACAGG + Intergenic
1197492578 X:127137223-127137245 GTTATGTTAAATTTAAACCCAGG + Intergenic
1198569348 X:137938612-137938634 GTAATGTGGAATTAAAACAAAGG - Intergenic
1200748987 Y:6927958-6927980 TAAATGTAGAAATTACACACAGG + Intronic
1202060530 Y:20882908-20882930 GGGATGTAGAATTAAAAGACAGG + Intergenic