ID: 1036280509

View in Genome Browser
Species Human (GRCh38)
Location 8:7396188-7396210
Sequence CAACGGACCAGGATGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036280500_1036280509 9 Left 1036280500 8:7396156-7396178 CCCAGGCACATCTCGACTGGGAA No data
Right 1036280509 8:7396188-7396210 CAACGGACCAGGATGGGAGGTGG No data
1036280501_1036280509 8 Left 1036280501 8:7396157-7396179 CCAGGCACATCTCGACTGGGAAG No data
Right 1036280509 8:7396188-7396210 CAACGGACCAGGATGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036280509 Original CRISPR CAACGGACCAGGATGGGAGG TGG Intergenic