ID: 1036283240

View in Genome Browser
Species Human (GRCh38)
Location 8:7418998-7419020
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036283240_1036283243 5 Left 1036283240 8:7418998-7419020 CCATTACAATGGGGCCAAAGGGA No data
Right 1036283243 8:7419026-7419048 AGTAATTATTGAACATAGCTGGG No data
1036283240_1036283242 4 Left 1036283240 8:7418998-7419020 CCATTACAATGGGGCCAAAGGGA No data
Right 1036283242 8:7419025-7419047 CAGTAATTATTGAACATAGCTGG No data
1036283240_1036283245 30 Left 1036283240 8:7418998-7419020 CCATTACAATGGGGCCAAAGGGA No data
Right 1036283245 8:7419051-7419073 AGTCCCAAAGTAACAAAAGATGG No data
1036283240_1036283244 6 Left 1036283240 8:7418998-7419020 CCATTACAATGGGGCCAAAGGGA No data
Right 1036283244 8:7419027-7419049 GTAATTATTGAACATAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036283240 Original CRISPR TCCCTTTGGCCCCATTGTAA TGG (reversed) Intergenic