ID: 1036283244

View in Genome Browser
Species Human (GRCh38)
Location 8:7419027-7419049
Sequence GTAATTATTGAACATAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036283241_1036283244 -8 Left 1036283241 8:7419012-7419034 CCAAAGGGAAGAACAGTAATTAT 0: 2
1: 5
2: 2
3: 29
4: 313
Right 1036283244 8:7419027-7419049 GTAATTATTGAACATAGCTGGGG No data
1036283240_1036283244 6 Left 1036283240 8:7418998-7419020 CCATTACAATGGGGCCAAAGGGA No data
Right 1036283244 8:7419027-7419049 GTAATTATTGAACATAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036283244 Original CRISPR GTAATTATTGAACATAGCTG GGG Intergenic