ID: 1036283245

View in Genome Browser
Species Human (GRCh38)
Location 8:7419051-7419073
Sequence AGTCCCAAAGTAACAAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036283241_1036283245 16 Left 1036283241 8:7419012-7419034 CCAAAGGGAAGAACAGTAATTAT No data
Right 1036283245 8:7419051-7419073 AGTCCCAAAGTAACAAAAGATGG No data
1036283240_1036283245 30 Left 1036283240 8:7418998-7419020 CCATTACAATGGGGCCAAAGGGA No data
Right 1036283245 8:7419051-7419073 AGTCCCAAAGTAACAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036283245 Original CRISPR AGTCCCAAAGTAACAAAAGA TGG Intergenic