ID: 1036283245 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:7419051-7419073 |
Sequence | AGTCCCAAAGTAACAAAAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1036283240_1036283245 | 30 | Left | 1036283240 | 8:7418998-7419020 | CCATTACAATGGGGCCAAAGGGA | No data | ||
Right | 1036283245 | 8:7419051-7419073 | AGTCCCAAAGTAACAAAAGATGG | No data | ||||
1036283241_1036283245 | 16 | Left | 1036283241 | 8:7419012-7419034 | CCAAAGGGAAGAACAGTAATTAT | 0: 2 1: 5 2: 2 3: 29 4: 313 |
||
Right | 1036283245 | 8:7419051-7419073 | AGTCCCAAAGTAACAAAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1036283245 | Original CRISPR | AGTCCCAAAGTAACAAAAGA TGG | Intergenic | ||