ID: 1036285662

View in Genome Browser
Species Human (GRCh38)
Location 8:7442510-7442532
Sequence CTATGTTTGTGGAAAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036285662_1036285668 17 Left 1036285662 8:7442510-7442532 CCTCCTTCTTTCCACAAACATAG No data
Right 1036285668 8:7442550-7442572 CAGGAAAATAAATGGTGCACAGG No data
1036285662_1036285670 30 Left 1036285662 8:7442510-7442532 CCTCCTTCTTTCCACAAACATAG No data
Right 1036285670 8:7442563-7442585 GGTGCACAGGTCACAGGCTCTGG No data
1036285662_1036285666 -2 Left 1036285662 8:7442510-7442532 CCTCCTTCTTTCCACAAACATAG No data
Right 1036285666 8:7442531-7442553 AGGCATCGAGCTAAATATTCAGG No data
1036285662_1036285669 24 Left 1036285662 8:7442510-7442532 CCTCCTTCTTTCCACAAACATAG No data
Right 1036285669 8:7442557-7442579 ATAAATGGTGCACAGGTCACAGG No data
1036285662_1036285667 9 Left 1036285662 8:7442510-7442532 CCTCCTTCTTTCCACAAACATAG No data
Right 1036285667 8:7442542-7442564 TAAATATTCAGGAAAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036285662 Original CRISPR CTATGTTTGTGGAAAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr