ID: 1036287050

View in Genome Browser
Species Human (GRCh38)
Location 8:7452150-7452172
Sequence TGTATGTTGTTAGTGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 2, 1: 0, 2: 2, 3: 24, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036287050_1036287053 19 Left 1036287050 8:7452150-7452172 CCTGCATCCACTAACAACATACA 0: 2
1: 0
2: 2
3: 24
4: 460
Right 1036287053 8:7452192-7452214 CATACAGACACACACATAAATGG 0: 2
1: 2
2: 46
3: 786
4: 4798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036287050 Original CRISPR TGTATGTTGTTAGTGGATGC AGG (reversed) Intronic
901520831 1:9783682-9783704 TGTATTTTTTTAGTGGAGACGGG - Intronic
901599798 1:10414546-10414568 TGTGTGTTATTAGTGGAGACGGG + Intronic
903097025 1:20986570-20986592 TGTATTTTTTTAGTGGAGACGGG - Intronic
903419427 1:23207932-23207954 TGTATGTTTTTAGTAGAGACAGG + Intergenic
905577022 1:39052984-39053006 TGTATTTTTTTAGTAGAGGCGGG - Intergenic
906498827 1:46325148-46325170 TGTATTTTTTTAGTAGATACAGG + Intergenic
907010084 1:50954712-50954734 TGTGTGTTTTTAGTAGAGGCAGG + Intronic
908318935 1:62962585-62962607 TGTGTGTTGTTAGATGATGTGGG - Intergenic
909448092 1:75769932-75769954 TGTATTTTTTTAGTAGATACGGG + Intronic
910604724 1:89071133-89071155 TGTATGTTCATAATTGATGCTGG + Intergenic
911199257 1:95028096-95028118 AGTATTTTGTTAATTGATGCTGG - Intronic
911734929 1:101326374-101326396 TGTATTTTGTTAGTAGAGACGGG - Intergenic
912114474 1:106388243-106388265 TGTATGTTTTTAGTAGAGACGGG - Intergenic
912823145 1:112883225-112883247 TGTATTTTTTTAGTAGAGGCAGG - Intergenic
913074481 1:115330121-115330143 TGCTTGATCTTAGTGGATGCTGG + Intronic
913660028 1:120998806-120998828 TGTATGTTTTTAGTAGAGACAGG - Intergenic
913677116 1:121151224-121151246 TTTGTGTTTTTAGTGGAGGCAGG - Intergenic
914011387 1:143781962-143781984 TGTATGTTTTTAGTAGAGACAGG - Intergenic
914028952 1:143938852-143938874 TTTGTGTTTTTAGTGGAGGCAGG - Intergenic
914160499 1:145129096-145129118 TTTGTGTTTTTAGTGGAGGCAGG + Intergenic
914166446 1:145179172-145179194 TGTATGTTTTTAGTAGAGACAGG + Intergenic
914650008 1:149690602-149690624 TGTATGTTTTTAGTAGAGACAGG - Intergenic
914837977 1:151223815-151223837 TTTGTGTTTTTAGTGGAGGCGGG - Intronic
915175059 1:154007745-154007767 TGTATTTTTTTAGTGGAGACAGG + Intronic
915237335 1:154493571-154493593 TGCATGTTTTTAGTAGGTGCAGG - Intronic
915240222 1:154515886-154515908 TGTATTTTTTTAGTAGAGGCGGG + Intronic
915591373 1:156872848-156872870 TGTATTTTTTTAGTGGAGACGGG + Intronic
918106966 1:181423899-181423921 TGTATGTTTTTAGAGGGGGCAGG + Intronic
918508724 1:185286395-185286417 TGTATGTTTTTAGTAGAGACGGG + Intronic
919952414 1:202377475-202377497 TGTATTTTGTTAGTAGAGACGGG + Intronic
920464417 1:206169741-206169763 TTTGTGTTTTTAGTGGAGGCAGG - Intergenic
920805371 1:209228958-209228980 TCTAGGTTATTAGTGGATGTTGG + Intergenic
921012221 1:211153250-211153272 TGTATTTTTTTAGTAGAGGCAGG + Intergenic
921637212 1:217510919-217510941 TGTATTTTTTTAGTGGATACAGG - Intronic
923588844 1:235300886-235300908 TGTATATTTTTAGTAGAGGCGGG + Intronic
923672749 1:236054811-236054833 TGTATATTTTTAGTGGACACAGG + Intronic
923674694 1:236069646-236069668 TGTATTTTTTTAGTAGAGGCGGG - Intergenic
924743975 1:246815594-246815616 TTTGTGTTTTTAGTGGAGGCGGG - Intergenic
1062766630 10:71138-71160 TGTGTGTTTTTAGTAGAGGCGGG - Intergenic
1063261314 10:4392511-4392533 TGTATTTTGTTAGTAGAAACAGG + Intergenic
1063923465 10:10954417-10954439 TGTATTTTTTTAGTAGAGGCAGG + Intergenic
1064097887 10:12437364-12437386 TGTATTTTCTTAGTGGAGACGGG + Intronic
1064170228 10:13025186-13025208 TGTAAATTGGTACTGGATGCTGG + Intronic
1064441099 10:15354322-15354344 TTTATATTTTTAGTGGAGGCGGG - Intronic
1065677458 10:28193383-28193405 TTTATGTTTTTAGTGGAGACGGG + Intronic
1065901434 10:30211666-30211688 TGGATGTTGAGAGTGGATGTTGG - Intergenic
1065962546 10:30745660-30745682 TGTATTTTTTTAGTGGAGACGGG + Intergenic
1065992331 10:31024451-31024473 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1066362633 10:34745925-34745947 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1066511723 10:36106636-36106658 TGTATTTTTTTAGTAGAGGCGGG - Intergenic
1066620431 10:37344036-37344058 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1067305638 10:45061488-45061510 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1068247386 10:54390466-54390488 TGTATGTTTTTAGTAGAGACAGG + Intronic
1069240322 10:66130159-66130181 TGTATGTTTGTGGTGGGTGCAGG - Intronic
1069508739 10:69024315-69024337 TGTATTTTTTTAGTAGATACGGG + Intergenic
1069682658 10:70296307-70296329 TGTATTTTTTTAGTAGATACAGG - Intergenic
1069750015 10:70739160-70739182 TGAGGGTTCTTAGTGGATGCAGG - Intronic
1069938103 10:71933248-71933270 TTTAAGTTGTTAGGGGAAGCTGG - Intergenic
1070288889 10:75102172-75102194 TGTATGTTGATAGTGGGAGAAGG + Intronic
1070907780 10:80089378-80089400 TGGATGTTGGATGTGGATGCAGG + Intronic
1072589854 10:96819357-96819379 TGTATTTTGTTAGTAGAGACAGG - Intergenic
1073058390 10:100716524-100716546 TGTATGTTAATAGGGTATGCGGG + Intergenic
1073113276 10:101075560-101075582 TGTATGCTGCTAGTGGAGGGAGG - Intergenic
1073231638 10:101975979-101976001 TGTATATTTTTAGTAGAGGCAGG - Intronic
1073796585 10:106995137-106995159 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1073819128 10:107239808-107239830 AGTATGTTTTTAGGGAATGCAGG - Intergenic
1073977885 10:109120708-109120730 TTTATCTGGCTAGTGGATGCAGG + Intergenic
1074474481 10:113757084-113757106 TGTGTGTTTTTAGTAGATACAGG + Intronic
1074607439 10:114987739-114987761 TGTATTTTTTTAGTGGAAACAGG + Intergenic
1075156349 10:119979313-119979335 TGTGTGTTTTTAGTGGAGACAGG + Intergenic
1077654909 11:4009439-4009461 TTTGTGTTTTTAGTGGAGGCAGG - Intronic
1078185171 11:9046179-9046201 TGTATTTTTTTAGTAGAGGCGGG + Intronic
1078258564 11:9682846-9682868 TTTATGTTTTTAGTAGATACAGG + Intronic
1078999699 11:16740918-16740940 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1079065224 11:17285252-17285274 TGTATGTTTTTAGTAGAGACGGG - Intronic
1080444227 11:32322889-32322911 TGTATGTTTTTAGTAGAGACGGG - Intergenic
1080631860 11:34084720-34084742 TGTATGTTTTTAGGGGAGCCAGG + Intronic
1082021162 11:47534551-47534573 TGTATGTTTTTAGTAGAGACAGG - Intronic
1083010022 11:59388210-59388232 TGAATGATGTTTCTGGATGCTGG + Intergenic
1083215263 11:61214747-61214769 TGTATATTTTTAGTGGATATGGG - Intergenic
1083218147 11:61233576-61233598 TGTATATTTTTAGTGGATATGGG - Intergenic
1083480847 11:62945566-62945588 TGTATGTTTTTAGTAGAGACGGG + Intronic
1083725137 11:64623925-64623947 TGTTTGTTTTTAGTGGATCTGGG + Intronic
1084202096 11:67566822-67566844 TGTATGTTTTTAGTAGAGACGGG - Intergenic
1087485303 11:98753120-98753142 TGTAAGTTCTTTGTAGATGCTGG - Intergenic
1088511119 11:110575992-110576014 TGTTTGTTTTTAGTAGAGGCAGG - Intergenic
1088573609 11:111248057-111248079 TGTATTTTTTTAGTGGAGACAGG + Intergenic
1089025099 11:115260845-115260867 TGTATTTTTTTAGTGGAGACGGG + Intronic
1090164147 11:124529296-124529318 TGTATGTGGCTAGATGATGCAGG - Intergenic
1090452108 11:126815706-126815728 TGTATGTTTTTAGTAGAGACGGG + Intronic
1091764427 12:3109439-3109461 TGTATGTCGCTTGTGGATTCTGG + Intronic
1092130029 12:6104512-6104534 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1092844507 12:12571548-12571570 TGTATTTTTTTAGTGGATACAGG - Intergenic
1093020138 12:14195764-14195786 TTTCTGTTGTTAGTGGTTTCTGG - Intergenic
1093051357 12:14508595-14508617 TTTATATTTTTAGTGGAGGCAGG - Intronic
1093066621 12:14665038-14665060 TTTATGTTTTTAGTGGAGACGGG - Intronic
1093212031 12:16319369-16319391 TGTGTGTTGTTGGGGGAAGCAGG + Intergenic
1093258813 12:16907544-16907566 TGTATGTTGTTTGAAGAAGCTGG - Intergenic
1093371641 12:18373674-18373696 TGTATTTTTTTAGTAGATACGGG - Intronic
1093469002 12:19481272-19481294 TGTATTTTTTTAGTAGAGGCAGG + Intronic
1094383134 12:29865351-29865373 TGTGTGTTTTTAGTAGAGGCAGG - Intergenic
1094428305 12:30338760-30338782 TGTATTTTTTTAGTAGAGGCAGG - Intergenic
1094632403 12:32188899-32188921 TGTATGTTTTTAGTAGAGACGGG + Intronic
1095047087 12:37518819-37518841 TGTATGTTTTTAGTGGAGATGGG - Intergenic
1095915001 12:47468996-47469018 TGTTTGTTTTTAGTGGAGGTAGG - Intergenic
1096152802 12:49325225-49325247 TGTATTTTTTTAGTGGAGACAGG + Intronic
1096735409 12:53649431-53649453 TGTATGTTTTTAGTAGAGACAGG - Intronic
1096948313 12:55434977-55434999 TGTGTGTTGTTAGATGATGTGGG + Intergenic
1097741737 12:63251389-63251411 TGTATTTTTTTAGTAGAGGCAGG + Intergenic
1098186972 12:67907025-67907047 TGTATATTGATTGTGGATGCTGG + Intergenic
1098199477 12:68039525-68039547 TTTATGTTTTTAGTTGATACGGG - Intergenic
1098222677 12:68286578-68286600 TGTATTTTTTTAGTGGAGACAGG - Intronic
1098278145 12:68834268-68834290 TTTATGTTTTTAGTGGAGACGGG - Intronic
1098528580 12:71514393-71514415 TTTATGTTTTTAGTAGATACGGG - Intronic
1099065840 12:77977516-77977538 TGGAAATTGTTAGTGGATGGAGG - Intronic
1099307358 12:80973998-80974020 TGTATTTTTTTAGTAGAGGCGGG + Intronic
1100507250 12:95234463-95234485 TGTATTTTTTTAGTAGAGGCAGG + Intronic
1101036504 12:100712833-100712855 TGTATATAGCTAATGGATGCTGG + Intergenic
1101436754 12:104670690-104670712 TGTATGATGTGTGTGTATGCAGG - Intronic
1101655265 12:106714775-106714797 AGTAGTTTGTTAGTGGATGGAGG - Intronic
1103096062 12:118133398-118133420 TGTATGTTTTTAGTGGAGACGGG + Intronic
1103483567 12:121267283-121267305 TGTATTTTTTTAGTAGATGCAGG + Intronic
1103774893 12:123360066-123360088 TGTGTGTTTTTAGTAGATACAGG - Intronic
1104334038 12:127875970-127875992 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1104649342 12:130520488-130520510 TGTGTGTTTTTAGTAGAGGCGGG - Intronic
1105000187 12:132686046-132686068 TGTATTTTTTTAGTGGAGACGGG + Intronic
1105369105 13:19787194-19787216 TTTATGTTTTTAGTGGAGACAGG - Intergenic
1105803800 13:23936959-23936981 TTTGTGTTTTTAGTGGAGGCAGG - Intergenic
1106064365 13:26330374-26330396 TTTGTGTTTTTAGTGGAGGCAGG + Intronic
1106600161 13:31180718-31180740 TTTATATTTTTAGTGGATACAGG - Intergenic
1107018356 13:35726957-35726979 TGTATTTTTTAAGTGGATGATGG - Intergenic
1108354723 13:49619902-49619924 TGTATTTTTTTAGTAGAGGCAGG - Intergenic
1109138982 13:58689673-58689695 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1110853569 13:80272952-80272974 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1111604866 13:90524287-90524309 TGTATGTTGTTGGTGTATAAAGG - Intergenic
1112514843 13:100044495-100044517 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
1113602674 13:111581654-111581676 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1115097449 14:29654343-29654365 TCTATGTTTTTAGTAGAGGCAGG + Intronic
1115216890 14:31022479-31022501 TGTATGTAGTAAGTGGATTTTGG - Intronic
1115231151 14:31162056-31162078 TGTATTTTGTTAGTAGAGACAGG - Intronic
1116717577 14:48447308-48447330 TTTATGTTCTTTGTGGATTCTGG - Intergenic
1117154980 14:52929807-52929829 TGTTTGTTGTTGGTGGGTGGGGG + Intronic
1118150885 14:63189345-63189367 TGAATCTTTTTAGTTGATGCAGG + Intergenic
1118649957 14:67880759-67880781 TTTACGTTGTTGGTGGGTGCTGG + Intronic
1119303494 14:73589489-73589511 TTTGTATTGTTAGTGGAGGCGGG + Intergenic
1119470467 14:74894718-74894740 TGTATTTTTTTAGTGGAGACGGG + Intronic
1120439807 14:84521581-84521603 TGTATGTTAATAGGAGATGCTGG + Intergenic
1121136757 14:91506118-91506140 TGTATGTTTTTAGTAGAGACAGG + Intronic
1121398122 14:93645841-93645863 TGTCTGGTGTTAGTGGTTGCTGG + Intronic
1122532575 14:102439035-102439057 TGTATTTTTTTAGTGGACACGGG + Intronic
1123997152 15:25726876-25726898 TGTATTTTTTTAGTAGATACGGG - Intronic
1125543292 15:40484855-40484877 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
1129328323 15:74813507-74813529 TGTGTGTTGTGGGTGGAAGCAGG + Intronic
1129860518 15:78857079-78857101 TGTATGTTTTTAGTAGAGACGGG - Intronic
1130046441 15:80449151-80449173 AATATGTTTTTAGTGGATGTTGG + Intronic
1130531490 15:84750128-84750150 TGTATTTTTTTAGTGGAGACGGG - Intronic
1131490947 15:92862288-92862310 TGTATGTTTTTAGTAGAGGTGGG + Intergenic
1133011715 16:2916460-2916482 TGTATTTTGTTAGTAGAGACGGG - Intronic
1133962684 16:10508325-10508347 TGTATTTTTTTAGTGGAGTCGGG + Intergenic
1134438038 16:14279768-14279790 TTTATGTTTTTAGTAGAGGCGGG - Intergenic
1134766590 16:16764161-16764183 TGTATATTTTTAGTGGAGACGGG + Intergenic
1134794946 16:17026493-17026515 TTTGTGTTTTTAGTGGAGGCGGG - Intergenic
1135129398 16:19839817-19839839 TTTATTTTTTTAGTGGATACAGG - Intronic
1135398881 16:22152035-22152057 TGTATGTTTTTAGTTGAGACGGG - Intronic
1136483913 16:30558934-30558956 TGTGTGTTTTTAGTGGAGACGGG - Intergenic
1136730396 16:32406221-32406243 TGTGTGTTTTTAGTAGATCCAGG + Intergenic
1138620798 16:58209674-58209696 TGTATTTTGTTAGTGGAGACGGG + Intergenic
1139239663 16:65378088-65378110 TTTATATTTTTAGTGGATGGGGG + Intergenic
1139547440 16:67656317-67656339 TGTGTGTTGGTAGTGGGAGCAGG + Intronic
1139824734 16:69747984-69748006 TGTATGTTTTTAGTAGAGGCGGG - Intronic
1140298242 16:73729353-73729375 TGTATGTTTTTAGTGGAGGCAGG - Intergenic
1142316086 16:89346068-89346090 TTTGTGTTGTTAGTGGAGACAGG - Intronic
1142613202 17:1120448-1120470 TGTATGTTTTTAGTAGAGACGGG + Intronic
1143487961 17:7265304-7265326 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
1144643578 17:16953110-16953132 TGCATGTGGTTATTTGATGCTGG + Intronic
1144800646 17:17923962-17923984 TGTATTTTTTTAGTGGAGACGGG - Intronic
1145077834 17:19869867-19869889 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1146001852 17:29135273-29135295 TGTATTTTTTTAGTAGAGGCAGG + Intronic
1146113735 17:30115744-30115766 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1147197293 17:38775682-38775704 TGTATTTTTTTAGTGGAGACGGG - Intronic
1147297376 17:39494942-39494964 TGTATTTTTTTAGTAGAGGCGGG + Intronic
1148353220 17:46956465-46956487 TGTATTTTCTTAGTAGAGGCAGG + Intronic
1149606994 17:57932098-57932120 TGTGTGTTTTTAGTGGAGACGGG - Intronic
1149757322 17:59198366-59198388 TGTATTTTTTTAGTGGAGACAGG - Intronic
1149941154 17:60868196-60868218 TGTATTTTTTTAGTGGGGGCAGG + Intronic
1150254263 17:63731435-63731457 TGTATTTTTTTAGTAGAGGCGGG + Intronic
1150653292 17:67023746-67023768 TGTTTGTTTTTAGTAGATACGGG + Intronic
1150787959 17:68177923-68177945 TGTATATTTTTAGTAGAGGCGGG + Intergenic
1151940777 17:77290430-77290452 TGTATTTTTTTAGTAGAGGCGGG + Intronic
1152803978 17:82346105-82346127 TGTATTTTTTTAGTGGAGACGGG - Intergenic
1153847153 18:9060478-9060500 TGTGTGTTTTTAGTAGATACAGG + Intergenic
1155313679 18:24549886-24549908 TTTATATTGTTAGGGGAGGCGGG + Intergenic
1155838338 18:30615051-30615073 TGTATGTTTTTAGTGGAAACGGG + Intergenic
1157850975 18:51050484-51050506 TGTATGTTTTTAGTAGAGACGGG - Intronic
1158595820 18:58815027-58815049 TGTATGTTTTTAGTAGAGACAGG + Intergenic
1159068408 18:63594665-63594687 TTTATGTTTTTAGTAGATACGGG - Intronic
1159312181 18:66723437-66723459 TGTGTGCTGTTAGTGGAGACGGG + Intergenic
1162218190 19:9153853-9153875 GGGATGATGGTAGTGGATGCTGG + Intronic
1162293247 19:9794438-9794460 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1162712300 19:12604476-12604498 TCTATGTTTTTAGTAGAGGCAGG - Intronic
1164031311 19:21408298-21408320 TGTGTGTTTTTAGTGGAGACGGG + Intronic
1164320396 19:24139065-24139087 TGTGTGTTTTTAGTAGATACAGG - Intergenic
1164631367 19:29763961-29763983 TGTATTTTTTTAGTGGAGACGGG + Intergenic
1164791216 19:30983491-30983513 TGTGTGTTTTTAGTGGAGGCAGG + Intergenic
1164897884 19:31893001-31893023 TGTATTTTTTTAGTAGATACGGG - Intergenic
1166206155 19:41270766-41270788 TGTGTGTTTTTAGTAGATGTGGG + Intronic
1167319291 19:48786188-48786210 TTTGTGTTTTTAGTGGAGGCAGG + Intergenic
1167805610 19:51781995-51782017 TTTATGTTTTTAGTGGAGACGGG - Intronic
1167962612 19:53119104-53119126 TGTATTTTTTTAGTAGAAGCGGG - Intronic
1168218229 19:54942079-54942101 TGTATTTTTTTAGTAGAGGCAGG - Intronic
1168655756 19:58126362-58126384 TGTATGTTGAAAGTGGATGATGG - Exonic
925774342 2:7319455-7319477 TGTATCTTGTCATTGAATGCTGG - Intergenic
925791540 2:7493310-7493332 TTTATGTTTTTAGTGGAGGTGGG - Intergenic
927460635 2:23295507-23295529 TGTATGGTGCTAGTGGAAGCAGG - Intergenic
927538623 2:23886266-23886288 TGTATTCTGTTGATGGATGCTGG - Intronic
927805680 2:26144526-26144548 TTTATATTTTTAGTAGATGCAGG - Intergenic
927984873 2:27402630-27402652 TGTGTGTTTTTAGTAGAGGCGGG - Intronic
928683940 2:33728602-33728624 TTTGTGTTTTTAGTGGAAGCGGG + Intergenic
929709568 2:44252538-44252560 GGTAGTTTGTTATTGGATGCTGG - Intergenic
930072438 2:47378057-47378079 TGTATGTTTTTAGTAGAGACAGG - Intronic
930286183 2:49431191-49431213 TGTAAGTTCTTTGTAGATGCTGG - Intergenic
930591621 2:53334357-53334379 GGTCTGTTGTTAGTGGGTGGTGG - Intergenic
931077512 2:58733168-58733190 CGTATGATGTTTGTGGAAGCAGG + Intergenic
931687196 2:64804512-64804534 TGTATTTTTTTAGTAGAGGCAGG + Intergenic
933105287 2:78316782-78316804 TGTATTTTTTTAGTGGAGACAGG + Intergenic
933665863 2:84964358-84964380 TTTATGTTTTTAGTAGAGGCAGG - Intergenic
935041169 2:99428814-99428836 TGTATTTTTTTAGTAGAGGCAGG - Intronic
935776388 2:106476540-106476562 TGTATTTTTTTAGTAGAGGCGGG - Intergenic
936368121 2:111879697-111879719 TGTATTTTTTTAGTAGAGGCGGG - Intronic
937107568 2:119332218-119332240 TGTAACTTATTATTGGATGCTGG + Intronic
938028507 2:127971458-127971480 TGTATGTTTTTAGTAGAGACGGG + Intronic
939068152 2:137508560-137508582 TGTATTTTTTTAGTGGAGACGGG + Intronic
939285055 2:140118480-140118502 TGTATGCAGTGAGTGGATGATGG + Intergenic
939455329 2:142427086-142427108 TGTATTTTTTTAGTAGATACGGG + Intergenic
939816390 2:146902134-146902156 TGTATTTTTTTAGTGGATACAGG - Intergenic
940201689 2:151158274-151158296 TTTGTGTTTTTAGTGGAGGCAGG + Intergenic
940324742 2:152413360-152413382 TGTATGTAGTTGATTGATGCCGG + Intronic
941822866 2:169859888-169859910 TGTATTTTTTTAGTGGAGACGGG + Intronic
941959244 2:171237579-171237601 TTTATGTTTTTAGTAGAGGCAGG + Intergenic
943361423 2:186923500-186923522 TGTGTGTTTTTAGTGGAGACAGG - Intergenic
943895062 2:193347323-193347345 TGTGTGTTTTTAGTAGAGGCGGG - Intergenic
943997860 2:194795062-194795084 TGTATTTTGTCAGTGGATTAAGG - Intergenic
944641414 2:201729705-201729727 TGTATTTTTTTAGTGAATACGGG - Intronic
945236139 2:207633302-207633324 TGTAAGTTGTTAGTGGAGTTTGG - Intergenic
946462610 2:219882449-219882471 TGTGTGTTTTTAGTGGAGACGGG + Intergenic
947979583 2:234397715-234397737 TGAACTTTGTGAGTGGATGCAGG + Intergenic
948794321 2:240394439-240394461 TTTATATTTTTAGTGGATACGGG - Intergenic
1170825956 20:19795808-19795830 TGTGTGTTGTTTGGGGGTGCTGG - Intergenic
1171230017 20:23476512-23476534 TGTATGTTGTTGGTGTATGTTGG + Intergenic
1171541651 20:25962467-25962489 TGTGTGTTTTTAGTGGAGACGGG - Intergenic
1171799415 20:29597893-29597915 TGTGTGTTTTTAGTGGAGACGGG + Intergenic
1171844641 20:30258604-30258626 TGTGTGTTTTTAGTGGAGACGGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172472969 20:35214511-35214533 TGTATTTTTTTAGTAGAGGCAGG - Intergenic
1172704580 20:36873390-36873412 CTTATGTTGTTTGTGGGTGCTGG - Intergenic
1173830910 20:46087584-46087606 TGTATATTTTTAGTGGAGACGGG - Intronic
1174548189 20:51342188-51342210 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1177307815 21:19343032-19343054 TTTATGTTGCTAGTGGCTTCAGG - Intergenic
1177724245 21:24946469-24946491 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1178062142 21:28864000-28864022 TGTATTTTTTTAGTAGAGGCAGG + Intergenic
1178081090 21:29065907-29065929 TGTATTTTTTTAGTAGAGGCAGG - Intronic
1178848377 21:36192553-36192575 TGTATTTTTTTAGTAGAGGCCGG + Intronic
1179121338 21:38548935-38548957 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1181020829 22:20101401-20101423 TGTATGTTTTTAGTAGAGACGGG - Intronic
1182359198 22:29736849-29736871 TGTGTGTTTTTAGTGGAGACGGG - Intronic
1183049126 22:35246444-35246466 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
1183377095 22:37471657-37471679 TTTGTGTTTTTAGTGGAGGCGGG - Intronic
1183449683 22:37886015-37886037 TGTATGTTTTTAGTAGAGACGGG - Intronic
1184166582 22:42732603-42732625 TGTATTTTGTTAGTAGAGACGGG + Intergenic
1184575035 22:45356902-45356924 TGTGTGTTTTTAGTGGAGACAGG + Intronic
950041021 3:9919469-9919491 TGTATTTTTTTAGTGGAGGCAGG - Intronic
951018361 3:17754785-17754807 TGTGTGTTTTTAGTAGATACGGG + Intronic
951730632 3:25807069-25807091 TGTATTTTTTTAGTGGAGACCGG - Intergenic
951952057 3:28210697-28210719 TGTATTTTTTTGGTGGATACAGG - Intergenic
952687882 3:36170818-36170840 TGTATTTTTTTAGTGGAGACAGG - Intergenic
954255508 3:49402862-49402884 TTTGTGTTTTTAGTGGATACGGG - Intronic
954341082 3:49954264-49954286 TGTATTTTTTTAGTGGAGACGGG - Intronic
956197066 3:66663585-66663607 TGTATGTTTTTAGTAGAGGCTGG - Intergenic
956774229 3:72551568-72551590 TTTATGTTTTTAGTGGAGACGGG - Intergenic
957469482 3:80639887-80639909 TTTATGTTTTTAGTAGAGGCAGG - Intergenic
958069678 3:88593984-88594006 TGTATTTTTTTAGTGGAGACGGG - Intergenic
958679861 3:97314572-97314594 TGAAGATTTTTAGTGGATGCTGG - Intronic
958906422 3:99946961-99946983 TGTATTTTTTTAGTAGAGGCGGG - Intronic
959178342 3:102946657-102946679 TGTATTTTTTTAGTGGAGACAGG + Intergenic
959250123 3:103931079-103931101 TTTATGTTCTTTGTGGATTCTGG + Intergenic
959335867 3:105064743-105064765 AACTTGTTGTTAGTGGATGCAGG - Intergenic
959780970 3:110232886-110232908 TGTATTTTTTTAGTAGAGGCAGG + Intergenic
961515242 3:127428119-127428141 TATATGTTGTTAATGAATTCAGG - Intergenic
961857087 3:129883115-129883137 TGTGTGTTTTTAGTAGAGGCAGG - Intronic
962023945 3:131527635-131527657 TGTATTTTTTTAGTGGAGACGGG - Intergenic
962492692 3:135909500-135909522 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
962574347 3:136742539-136742561 TGTATTTTTTTAGTGGAGACGGG - Intronic
963126226 3:141819596-141819618 TGTATATTTTTAGTGGAGACAGG - Intergenic
963222353 3:142826178-142826200 TGTATTTTTTTAGTAGAGGCGGG + Intronic
963799469 3:149661593-149661615 TGTATTTTTTTAGTAGAGGCAGG + Intronic
964001051 3:151772243-151772265 TGTATGTTGTTACTGGACTTGGG + Intergenic
964529824 3:157655517-157655539 TGTATGTTTTTAGTAGAGACAGG + Intronic
964546409 3:157839053-157839075 TGTATGTTTTTAGTAGAGACAGG - Intergenic
964580851 3:158235942-158235964 TTTATATTTTTAGTAGATGCAGG - Intronic
964852094 3:161105478-161105500 TGTATGCCTTTAGTTGATGCTGG + Intronic
966170950 3:177079256-177079278 TGTATTTTTTTAGTGGAGACGGG - Intronic
966999852 3:185323761-185323783 TGTATGTTTTTAGTTATTGCTGG + Intronic
967349267 3:188494127-188494149 TATATGTAATTAGGGGATGCAGG + Intronic
968807627 4:2786136-2786158 TGTGTGTTTTTAGTGGAGACTGG + Intergenic
969572091 4:8015090-8015112 TTTATATTGTTAGTGGAGACGGG + Intronic
969861307 4:10037775-10037797 TGTGTGTTTTTAGTGGAGACAGG - Intronic
972564826 4:40260312-40260334 TGTATGTTTTTAGTAGAGACAGG - Intergenic
972585052 4:40430018-40430040 TGTATTTTTTTAGTGGAGACGGG - Intronic
973329086 4:48894317-48894339 TGTATTTTTTTAGTGGAGACGGG - Intronic
973586677 4:52399878-52399900 TAGATGTTGTTAGTTGATGCTGG + Intergenic
974122725 4:57659181-57659203 TGTGTCTTGATAGTAGATGCAGG - Intergenic
974349145 4:60722618-60722640 TGTATTTTGTTAGTAGAGACGGG + Intergenic
977286567 4:95114971-95114993 TGTATGATGACAGTGGATGGTGG + Intronic
977629014 4:99220943-99220965 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
978939242 4:114416613-114416635 TGTATTTTTTTAGTAGATACAGG + Intergenic
979066994 4:116150091-116150113 TGTATGTTTTTAAGGGATGGCGG - Intergenic
979422709 4:120526091-120526113 CTTATGTTTTTAGTGCATGCAGG - Intergenic
980905066 4:138940252-138940274 CTTATGTTGTGATTGGATGCTGG - Intergenic
980934783 4:139216406-139216428 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
981191121 4:141864837-141864859 TGTATTTTTTTAGTGGAGACGGG + Intergenic
981990755 4:150917753-150917775 TGTATTTTTTTAGTAGAGGCAGG - Intronic
982846515 4:160259677-160259699 TTTGTGTTTTTAGTGGAGGCAGG + Intergenic
983608384 4:169616169-169616191 TCTATGATGTTAGTGGAATCAGG + Intronic
983786147 4:171732153-171732175 TGTATGTTTTTAGTAGAGACGGG - Intergenic
985977627 5:3433526-3433548 TGTATGTTTTTAGTAGAGACAGG + Intergenic
986727246 5:10608175-10608197 TGTATTTTTTTAGTGGAGACAGG - Intronic
987382728 5:17300688-17300710 TGCCTGTTGTAAGTGAATGCAGG + Intergenic
988049962 5:26015192-26015214 TGTATTTTTTTAGTGGACACTGG + Intergenic
988119591 5:26943338-26943360 TGTATTTTTTTAGTAGAGGCAGG - Intronic
988136105 5:27173852-27173874 TGGATGTTGGTAATGGAAGCAGG - Intergenic
988510181 5:31858132-31858154 TGTGTGTTTTTAGTAGAGGCGGG + Intronic
990013170 5:51024950-51024972 TTTATGTTGTTGGTGGAATCTGG + Intergenic
990353538 5:54942080-54942102 TGTATTTTTTTAGTGGAGACAGG + Intergenic
990496913 5:56357568-56357590 TGTATGTACTGAGTGGAGGCAGG + Intergenic
990656731 5:57965404-57965426 GGCCTGTTGTTAGTGTATGCAGG - Intergenic
991338366 5:65576547-65576569 TTTATGTTTTTAGTGGAGACGGG + Intronic
991376273 5:65971223-65971245 TTTATCTTGTTTGTGCATGCTGG + Intronic
992581699 5:78184511-78184533 TGTATTTTTTTAGTAGAGGCGGG - Intronic
992665007 5:78999504-78999526 TGTATTTTTTTAGTAGAGGCGGG + Intronic
992682437 5:79166602-79166624 TGTGTGTTTTTAGTGGAGACAGG - Intronic
993918277 5:93768596-93768618 TATATGTATTTAGTGGATGGTGG + Intronic
994904740 5:105824375-105824397 TGTATTTTTTTAGTGGAGACAGG - Intergenic
995421346 5:111970652-111970674 TCTGTGTTTTTAGTGGAGGCGGG - Intronic
997912709 5:137891854-137891876 TGTATGTTTTTAGTAGAGACAGG + Intronic
1000346879 5:160321758-160321780 TGTATTTTTTTAGTGGAGACAGG - Intronic
1001189466 5:169614739-169614761 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1003860343 6:10317120-10317142 TGTGTGTTTTTAGTGGAGACGGG + Intergenic
1004139127 6:12999424-12999446 TGTATTTTGTTAGTAGAGACAGG - Intronic
1004373546 6:15073205-15073227 TCTATGTTTTTAGTGGAGGCGGG + Intergenic
1004416016 6:15424684-15424706 TGTATTTTTTTAGTGGAGGCAGG - Intronic
1004689637 6:17982267-17982289 TGTATTTTTTTAGTGGAGACAGG + Intronic
1005057869 6:21746668-21746690 TTTGTGTTTTTAGTGGAGGCAGG + Intergenic
1005217030 6:23542363-23542385 TGTATATTTTTAGTAGAGGCAGG - Intergenic
1005448376 6:25949385-25949407 TGTATTTTGTTAGTAGAGACAGG + Intergenic
1005728631 6:28674055-28674077 TGGATGTTGTTAGTGTGTCCCGG - Intergenic
1006141647 6:31932940-31932962 CGTATTTTGTTAGTGGAGACGGG - Intronic
1006149180 6:31976868-31976890 CGTATTTTGTTAGTGGAGACGGG - Intronic
1006275013 6:32997591-32997613 TGTGTGTTTTCAGTGGATACGGG + Intergenic
1006649181 6:35536910-35536932 TGTATGTTTTTAGTAGAGACGGG - Intergenic
1007202817 6:40124800-40124822 TTTATGTTTTTAGTAGATACAGG + Intergenic
1007900531 6:45407394-45407416 TGTATTTTTTTAATGGATGAAGG - Intronic
1008532091 6:52471692-52471714 TGTATTTTTTTAGTAGATGCAGG - Intronic
1009759206 6:67981349-67981371 TTTAAGTTGTTAGGTGATGCAGG - Intergenic
1010532344 6:76984018-76984040 TGTATGTTGATAGGGGATATTGG - Intergenic
1010777946 6:79908335-79908357 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1011785893 6:90844803-90844825 TGTATTTTTTTAGTAGAGGCAGG + Intergenic
1012277436 6:97291324-97291346 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
1013792393 6:113852448-113852470 AGTATGTTGAGAGTGGAAGCTGG - Intergenic
1014116473 6:117673540-117673562 TGTGTGTTTTTAGTAGAGGCGGG - Intergenic
1014372256 6:120625384-120625406 TGTATTTTGTTAGTAGAGACGGG + Intergenic
1015503630 6:133959209-133959231 TTTATATTTTTAGTAGATGCAGG + Intronic
1016112909 6:140248246-140248268 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1016122014 6:140355556-140355578 TCTATGTTCTTAATGGTTGCTGG + Intergenic
1017100228 6:150842883-150842905 TTTGTGTTGTTAGTAGAGGCGGG + Exonic
1017105912 6:150887626-150887648 TCTATATTTTTAGTGGAGGCGGG + Intronic
1017108914 6:150913954-150913976 TGTATTTTTTTAGTAGAGGCAGG - Intronic
1017925579 6:158909206-158909228 TGTATTTTTTTAGTGGAGACAGG - Intronic
1019028999 6:168994525-168994547 TGTATTTTGTTAGTGCTTGTTGG - Intergenic
1019561150 7:1658385-1658407 TGTGTGTTTTTAGTAGAGGCAGG - Intergenic
1019581537 7:1766096-1766118 TTTGTGTTTTTAGTGGAGGCGGG + Intergenic
1020089200 7:5328681-5328703 TGTATTTTTTTAGTAGAGGCGGG + Intronic
1020133359 7:5572022-5572044 TGTATTTTTTTAGTGGAGACGGG + Intergenic
1020165176 7:5802015-5802037 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1022835742 7:34112319-34112341 TGTATTTTTTTAGTAGATACGGG - Intronic
1023010520 7:35921265-35921287 TGTATTTTTTTAGTAGATTCAGG - Intergenic
1024080305 7:45850308-45850330 TGTATTTTTTTAGTAGATTCAGG + Intergenic
1024707503 7:51976511-51976533 TTTATGTTTTTAGTAGAGGCAGG - Intergenic
1024746819 7:52416992-52417014 TGTATTTTTTTAGTAGAGGCGGG - Intergenic
1025118275 7:56277322-56277344 TTTGTGTTGTTAGTAGATACAGG - Intergenic
1025293091 7:57748667-57748689 TGTGTGTTTTTAGTGGAGACGGG - Intergenic
1025730631 7:64103689-64103711 TGTATTTTTTTAGTAGAGGCAGG + Intronic
1025779389 7:64586439-64586461 TGTATGTTCCTTATGGATGCTGG + Intergenic
1025826967 7:65018495-65018517 TGTGTGTTTTTAGTAGATACGGG - Intergenic
1026060390 7:67020409-67020431 TTTATGTTTTTAGTAGATACCGG + Intronic
1026098631 7:67366773-67366795 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1026209283 7:68289088-68289110 TGTATTTTGTTAGTGGAGGCAGG + Intergenic
1026256845 7:68719818-68719840 TGAGTACTGTTAGTGGATGCTGG - Intergenic
1026648082 7:72190182-72190204 TGTATGTTTTTAGTAGAGACGGG - Intronic
1026918126 7:74135114-74135136 TGTATTTTTTTAGTAGAGGCAGG - Intergenic
1027163360 7:75818000-75818022 TTTATATTTTTAGTGGAGGCGGG + Intronic
1029533609 7:101142108-101142130 TGTGTGTTTTTAGTGGAGACGGG - Intergenic
1030962460 7:115943743-115943765 TGAATGTTGATAGTTGATGCTGG + Intronic
1031262600 7:119540564-119540586 TGTAAGTTGTCATTGGATACTGG - Intergenic
1031388589 7:121184205-121184227 TGTATTTTTTAAGTGGATGTGGG + Intronic
1031775136 7:125899488-125899510 TGTATGTTCATTGGGGATGCTGG - Intergenic
1033153220 7:138934657-138934679 CGTATCTTGTTAGAGGATGAAGG - Intronic
1033497437 7:141913547-141913569 TGTATGTTTTTAGTAGAGGTGGG - Intronic
1033615530 7:143010827-143010849 TTTATGTTGTTAGTAGAGACGGG - Intergenic
1033936431 7:146591608-146591630 TGAATGTTGACAATGGATGCAGG - Intronic
1034083024 7:148298211-148298233 TGGATGGTGCTAGTGGATGGTGG + Intronic
1035622254 8:1043185-1043207 TGGGTGTTGGTGGTGGATGCGGG + Intergenic
1035831031 8:2694450-2694472 TGTATGTTTTTAGTAGAGACGGG - Intergenic
1036287050 8:7452150-7452172 TGTATGTTGTTAGTGGATGCAGG - Intronic
1036334431 8:7859372-7859394 TGTATGTTGTTAGTGGATGCAGG + Intronic
1037251964 8:16905897-16905919 TGTATTTTTTTAGTGGAGACAGG + Intergenic
1038080960 8:24135688-24135710 TGCATGTTGTTGGTGGCTCCAGG + Intergenic
1038311157 8:26447397-26447419 TTTACGTTTTTAGTGGAGGCGGG + Intronic
1038357820 8:26846595-26846617 TGTATGTTTTTAGTAGAGACAGG - Intronic
1038466530 8:27769968-27769990 TGTATTTTGTTAGTAGAAACGGG - Intronic
1038628872 8:29221272-29221294 TTTGTGTTTTTAGTGGAGGCGGG + Intronic
1038710621 8:29941003-29941025 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1039296359 8:36160030-36160052 TGTGTGTTTTTAGTGGAGACAGG - Intergenic
1039550306 8:38438679-38438701 TGTATGATGTATGTGGATTCTGG - Intronic
1039935133 8:42036437-42036459 TGTATTTTTTTAGTGGAGACGGG - Intronic
1041770081 8:61463893-61463915 TGTATTTTTTTAGTAGATACGGG - Intronic
1042344967 8:67717958-67717980 GGTATACTGTTAGTGGAAGCAGG + Intronic
1042576431 8:70225373-70225395 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1043052505 8:75401369-75401391 TTTGTGTTTTTAGTAGATGCTGG - Intergenic
1043547756 8:81334464-81334486 TGTATTTTTTTAGTAGAGGCAGG + Intergenic
1043949181 8:86289131-86289153 TGTATTTTCTTAGTGGAAACGGG - Intronic
1044071069 8:87760373-87760395 TGCATGTTGTTAGTGGGGGTGGG - Intergenic
1044646535 8:94449433-94449455 TGTATTTTTTTAGTGGAAACAGG - Intronic
1045228324 8:100273954-100273976 TGTATTTTTTTAGTGGAGACAGG + Intronic
1046265941 8:111830251-111830273 TGTATGTTTTTAGTAGAGACGGG - Intergenic
1047026981 8:120835029-120835051 GGTATGCTGTTAGAGGATGCAGG + Intergenic
1047261379 8:123263658-123263680 TGTATTTTTTTAGTAGAGGCAGG - Intronic
1047350708 8:124070987-124071009 AGTATGTTTATAGTGAATGCTGG - Intronic
1047726819 8:127691047-127691069 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1050096188 9:2069381-2069403 TGTATTTTTTTAGTGGAGACGGG - Intronic
1050690646 9:8223067-8223089 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1051268191 9:15329297-15329319 TGTATCTTGTTACTGGATCTGGG - Intergenic
1051530833 9:18101322-18101344 TGTATTTTTTTAGTAGATACGGG - Intergenic
1052868957 9:33484581-33484603 TGTATTTTTTTAGTGGAGACAGG + Intergenic
1052891646 9:33705942-33705964 TGTATTTTTTTAGTGGAGACAGG - Intergenic
1053344935 9:37371318-37371340 TGTATGTTGTGAGCCGCTGCAGG - Intergenic
1053504306 9:38628211-38628233 TGTATTTTTTTAGTAGAGGCGGG + Intergenic
1054787329 9:69221722-69221744 TTTATGTTTTTAGTGGAGACAGG + Intronic
1055438955 9:76320251-76320273 TGTATTTTTTTAGTAGATACGGG - Intronic
1055673015 9:78626169-78626191 TGTATGGTGTCAGTGGGTCCGGG + Intergenic
1057016835 9:91659305-91659327 TGTATATTTTTAGTGGAGACAGG - Intronic
1057910837 9:99019384-99019406 TGTTTGTTTTTAGTGGAGACAGG + Intronic
1058969854 9:110070988-110071010 TGTATGTTTTTAGTAGAGGCGGG - Intronic
1059023867 9:110603936-110603958 TGTGTGTTTTTAGTAGAGGCGGG + Intergenic
1059677871 9:116557046-116557068 TGTATTTTTTTAGTAGAGGCGGG - Intronic
1060245692 9:121944334-121944356 TTTGTGTTTTTAGTGGAGGCGGG - Intronic
1061436887 9:130569372-130569394 TGTATATTTTTAGTGGAGACAGG - Intergenic
1061565807 9:131439077-131439099 TGTGTGTTGTTTGGGGACGCTGG + Intronic
1061702941 9:132429669-132429691 TGTATTTTGTTAGTAGAGACGGG - Intronic
1185601960 X:1346265-1346287 TTTATATTTTTAGTGGAGGCGGG - Intronic
1186090809 X:6047304-6047326 TTTGTGTTGTTAGTAGATACTGG - Intronic
1186332487 X:8549850-8549872 TTTTTGTTGTTAATGGATACTGG - Intronic
1187042260 X:15609258-15609280 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1187703012 X:21982158-21982180 TGTATTTTTTTAGTGGAGACGGG - Intronic
1187712606 X:22068957-22068979 TGTATGTTTTTAGTAGAGTCGGG - Intronic
1187855129 X:23629318-23629340 TGTATTTTTTTAGTAGAGGCAGG - Intergenic
1189372752 X:40442683-40442705 TGTATTTTTTTAGTGGAGACGGG - Intergenic
1189392067 X:40584651-40584673 TGTATTTTTTTAGTGGAGACGGG + Intronic
1189789979 X:44594392-44594414 AGAATGTTGTTACTGGATCCTGG + Intergenic
1190329958 X:49229821-49229843 TGTATTTTTTTAGTAGAGGCAGG + Intronic
1191583679 X:62794964-62794986 TGTGTTTTGTTAGTAGAGGCGGG - Intergenic
1191858891 X:65649864-65649886 CGTATGTTATTTGTGGATGGTGG - Intronic
1192302171 X:69916576-69916598 TGTATGTTTTTAGTAGAGACAGG + Intronic
1192623330 X:72702274-72702296 TGTATGTTTTTAGTAGATATGGG - Intronic
1192818681 X:74620144-74620166 TTTGTGTTTTTAGTAGATGCGGG + Intergenic
1192882904 X:75306738-75306760 TGTATATTCTTAGTGGAGACGGG + Intergenic
1193102207 X:77627050-77627072 TGTATTTTTTTAGTGGAAACGGG - Intronic
1193435113 X:81464928-81464950 TGTATGTATTTATGGGATGCAGG + Intergenic
1194504573 X:94716318-94716340 TGTGTGTTTTTTGTAGATGCGGG + Intergenic
1194651390 X:96518849-96518871 TGTATGTTTTTAGTAGAGACGGG + Intergenic
1194715850 X:97286220-97286242 TGTATTTTTTTAGTAGATACGGG + Intronic
1195073366 X:101302840-101302862 TTTATGTTTTTAGTAGATACAGG + Intergenic
1196607966 X:117676886-117676908 TGTATTTTTTTAGTGGATACGGG - Intergenic
1197562204 X:128037308-128037330 TGTATTTTTTTAGTAGATACGGG + Intergenic
1197751336 X:129965826-129965848 TGTATTTTTTTAGTGGAGACGGG + Intergenic
1198760327 X:140025799-140025821 TGTATGTTTTTAGTAGAGACAGG + Intergenic
1199106000 X:143869001-143869023 TGTATGTTCTTAGAAGAAGCTGG + Intergenic
1199596311 X:149509047-149509069 TGTACATTGGGAGTGGATGCTGG - Intronic
1200422405 Y:2985596-2985618 TTTGTGTTTTTAGTGGAGGCAGG + Intergenic