ID: 1036287185

View in Genome Browser
Species Human (GRCh38)
Location 8:7453390-7453412
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036287185_1036287189 7 Left 1036287185 8:7453390-7453412 CCCCCTGGGCTTCATAACAATTG 0: 2
1: 0
2: 0
3: 8
4: 109
Right 1036287189 8:7453420-7453442 CTTCTTATTAATCCTTCCAGAGG 0: 2
1: 0
2: 0
3: 28
4: 196
1036287185_1036287192 23 Left 1036287185 8:7453390-7453412 CCCCCTGGGCTTCATAACAATTG 0: 2
1: 0
2: 0
3: 8
4: 109
Right 1036287192 8:7453436-7453458 CCAGAGGTGTCCCATGTGTATGG 0: 2
1: 0
2: 1
3: 4
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036287185 Original CRISPR CAATTGTTATGAAGCCCAGG GGG (reversed) Intronic
900790201 1:4675016-4675038 CCTTTGCCATGAAGCCCAGGAGG + Intronic
903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG + Intronic
904798178 1:33073141-33073163 CATTTGCTAGGAAGCCAAGGTGG + Intronic
905118007 1:35659309-35659331 TAATTAATATAAAGCCCAGGAGG - Intergenic
905485038 1:38289732-38289754 CATTTGGGATGAAGACCAGGAGG + Intergenic
907348116 1:53801304-53801326 AAAATGTAAGGAAGCCCAGGGGG - Intronic
907835548 1:58105236-58105258 CAATTATTCTTAAGCCCAGAAGG - Intronic
909455676 1:75845924-75845946 CAATAGGTATGAAGCCATGGTGG - Intronic
916611731 1:166398238-166398260 CAATAGTTAGGCATCCCAGGAGG + Intergenic
916916732 1:169415367-169415389 CAAGGGTTATGAAGGACAGGAGG - Intronic
917460673 1:175226374-175226396 CCATTGTTCTGAACACCAGGGGG + Intergenic
917566649 1:176219210-176219232 AAATTATTATGATGACCAGGTGG - Intergenic
920202259 1:204266761-204266783 CAATTGTTATGAAGCAGGAGAGG - Intronic
923757892 1:236810050-236810072 CTATTTTTATGAAGCCCTGAAGG - Intronic
1062819118 10:520766-520788 AAATTGTTAAAAAGCCCAAGGGG - Intronic
1064101752 10:12470154-12470176 GAATTGTTATGAAATCCAGGAGG - Intronic
1066157008 10:32689371-32689393 CATTTGTTATAAAGCCTTGGGGG - Intronic
1069806071 10:71125807-71125829 CAGCTGATATGGAGCCCAGGGGG - Intergenic
1073133918 10:101208970-101208992 CAATTGTTATGAGCCAAAGGGGG - Intergenic
1074375612 10:112938746-112938768 CAATTGTGATGAAGCCTTGGGGG + Intergenic
1074883225 10:117674537-117674559 CAATTGTTAGGAACCTGAGGAGG - Intergenic
1081198030 11:40185328-40185350 CAATTTCTATTAAGCCCTGGAGG - Intronic
1085973181 11:81619013-81619035 CAATTGTTTTGTAGCCAAGCTGG - Intergenic
1087073888 11:94110632-94110654 CAAAGGTTATGAATACCAGGAGG + Intronic
1090320257 11:125837081-125837103 GAATTTATATGGAGCCCAGGAGG - Intronic
1090873256 11:130766658-130766680 ATATTGTTATGAAAGCCAGGTGG - Intergenic
1092449329 12:8587167-8587189 CAATTGATATGATGCACAGGAGG - Intergenic
1103366583 12:120388768-120388790 CCATTTTTATAAAGCCCATGGGG - Intergenic
1103560763 12:121792334-121792356 CAATGTTGATGAAGCCCAGATGG + Intronic
1107972571 13:45657860-45657882 CAGTTGTGATAAAGCCCATGCGG - Intergenic
1110224367 13:73104450-73104472 CAGTTGTTAAGAAGCCCTGCTGG - Intergenic
1112084972 13:96020470-96020492 CAATGTTTGTGAAGCCCAGAGGG - Intronic
1113299371 13:109000365-109000387 CAAGTTTTATGAGGCCCAGTGGG + Intronic
1116848374 14:49885299-49885321 CAATGGTAATAAAGGCCAGGTGG - Intergenic
1121157666 14:91701713-91701735 CATGTGGTATGAAGGCCAGGAGG + Intronic
1121275992 14:92668014-92668036 CAATTATTATGAAAGACAGGAGG - Intronic
1126890129 15:53196290-53196312 CAATTGTTATGATTAGCAGGTGG - Intergenic
1127655520 15:61051760-61051782 GAAATGTTTTGAAGCCCAGGCGG - Intronic
1133473065 16:6094333-6094355 CATTTCTTTTGAACCCCAGGTGG + Intronic
1137501872 16:49018136-49018158 CAATTCTTGGGAAGCCAAGGTGG - Intergenic
1141101216 16:81198819-81198841 CAAATGGTCAGAAGCCCAGGAGG + Intergenic
1141774222 16:86111484-86111506 CAATCTGTAGGAAGCCCAGGAGG + Intergenic
1142256214 16:89015038-89015060 GAATTTATGTGAAGCCCAGGTGG + Intergenic
1143410049 17:6703258-6703280 CAACTCTTATGGAGCCCAGTGGG - Intronic
1155244546 18:23894820-23894842 CAAGTGCTATGCAGCCCAGTTGG - Intronic
1159565338 18:70041819-70041841 CAAATGTTATGTAGCCAAGTAGG - Intronic
1161783593 19:6309800-6309822 CAGTGGTGATGAAGACCAGGCGG + Exonic
1165441346 19:35829999-35830021 CAATTGTCATCAGGCCCAGCTGG - Intronic
1166555294 19:43695613-43695635 AAATTGTTAAGAAGGCCAGCCGG + Intergenic
926715117 2:15918359-15918381 CAAGTGTTCTGAAGCACAGTGGG + Intergenic
930486571 2:52018173-52018195 AAATTGTTATGAAGTTCAGCTGG + Intergenic
931137050 2:59414572-59414594 AAATTGTTATAAAGCTCAGCTGG + Intergenic
932399989 2:71473697-71473719 CAATTTTTTTTAAGTCCAGGTGG - Intronic
932633630 2:73368902-73368924 CAATTGTTATGTAACAGAGGTGG - Intergenic
937574971 2:123409164-123409186 CAATTTTTTGGAAGCCAAGGTGG + Intergenic
937643586 2:124241101-124241123 CAAATCTTCTGAAGCCCATGTGG - Intronic
939225411 2:139357897-139357919 GAATGGTTACAAAGCCCAGGTGG + Intergenic
940201478 2:151156170-151156192 CAATTTTTAAGAAGTCAAGGAGG + Intergenic
940269795 2:151877748-151877770 CAAATGCTCTGAAGCCCAAGAGG + Intronic
942263575 2:174197518-174197540 CAACTCCAATGAAGCCCAGGGGG + Intronic
946212243 2:218156514-218156536 AAAATGTTATGTACCCCAGGAGG - Intergenic
1176093538 20:63329384-63329406 GAACTGTCATGGAGCCCAGGAGG + Intronic
1178176294 21:30103509-30103531 GTATTGATATGAAGGCCAGGTGG + Intergenic
1180716381 22:17875362-17875384 CAAGTGTCATGTACCCCAGGAGG - Intronic
1181730410 22:24842228-24842250 AACATGTCATGAAGCCCAGGTGG - Intronic
1184879633 22:47296773-47296795 CATTTGAAATGAAGCCCAGCGGG + Intergenic
952127310 3:30315983-30316005 CAATGGTTATGAAAACCTGGAGG - Intergenic
953739024 3:45520659-45520681 CAAATGTAATGATGCCGAGGAGG - Intronic
953809720 3:46101687-46101709 CAGTTGATAAGAAGGCCAGGTGG - Intergenic
954938785 3:54351989-54352011 CAATAGCCATGAAGACCAGGAGG - Intronic
958764279 3:98346088-98346110 AAAATGTTAAGAAGCCCAGGAGG + Intergenic
959169728 3:102830374-102830396 CAGTTGATATGGAGCCCAGAGGG + Intergenic
959815186 3:110666316-110666338 AAATTGTTATGAAGTTCAGCTGG - Intergenic
966169058 3:177057009-177057031 CCTTTGTTATGAAGGCCAAGGGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
969999225 4:11347083-11347105 TCATGGTTATGAGGCCCAGGAGG - Intergenic
974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG + Intergenic
977031163 4:91885201-91885223 AAATATTTATGAAGCCCAGCTGG - Intergenic
978933549 4:114347737-114347759 CATTTGTTGTAATGCCCAGGTGG + Intergenic
980817046 4:137961559-137961581 CAAATGTTATCAAGCCTAGTTGG + Intergenic
981106226 4:140884927-140884949 CAAGTGCTTGGAAGCCCAGGAGG - Intronic
983255304 4:165393555-165393577 CCAAGGTTTTGAAGCCCAGGAGG + Intronic
983942239 4:173547098-173547120 GAATTGAGATGAATCCCAGGTGG + Intergenic
988089305 5:26515324-26515346 CAGTTGTCGTGAAGCCCAAGGGG - Intergenic
988428567 5:31092518-31092540 CAGTTTTTATGAAGCCCAGAAGG - Intergenic
989261917 5:39428130-39428152 CAATTTTAATGAAACTCAGGTGG + Intronic
991164320 5:63545036-63545058 AAATTCTTATGTAGGCCAGGTGG + Intergenic
991456657 5:66811134-66811156 CAACTGTGAGGGAGCCCAGGTGG - Intronic
991491750 5:67190611-67190633 CAATTGTCATGAATACCACGTGG - Intronic
991521462 5:67502624-67502646 CAATGGTTATTTAGCCAAGGGGG + Intergenic
992258813 5:74949408-74949430 CCACAGTTATGAAGCCCAGCTGG + Intergenic
995153185 5:108876157-108876179 CCATTTTTATGCAGCCCACGAGG + Intronic
997050885 5:130378262-130378284 CGATTGTTATGAATCCAAGCTGG - Intergenic
997229276 5:132230932-132230954 CAAGTGTTACGAAGCACACGGGG - Intronic
999294266 5:150448547-150448569 AAATTGTTCTGAACACCAGGAGG - Intronic
1003813001 6:9805249-9805271 AAATGGTTGTGAAGCTCAGGAGG - Intronic
1010057761 6:71585731-71585753 CAACTGTATTGAAGCCCAGCTGG + Intergenic
1010821392 6:80419578-80419600 CAATTGATATGGATCCCAGAGGG - Intergenic
1011913247 6:92468450-92468472 CATTTGTTATCAAGCTGAGGAGG - Intergenic
1017207006 6:151813916-151813938 CAAATGTTGTCAACCCCAGGAGG + Intronic
1021886103 7:25141213-25141235 CAATTATTATGAATATCAGGAGG + Intronic
1022823379 7:33983536-33983558 CAATTGTTCTGCAACCTAGGAGG + Intronic
1022894923 7:34740438-34740460 CAATTGTTACGAAGTTCAGCTGG + Intronic
1026634617 7:72070495-72070517 CAATAATTATGAAGAGCAGGTGG - Intronic
1026826259 7:73583827-73583849 CAAGTTTTATGTAGCCCAGTTGG + Intergenic
1027417716 7:77990584-77990606 AAATTGTTATGAAGTTCAGCTGG + Intergenic
1028060538 7:86308683-86308705 TAATTGTTATGTAGCCCTGGTGG + Intergenic
1031839635 7:126722119-126722141 AAATTTTTATGACGCCCAGGAGG - Intronic
1036287185 8:7453390-7453412 CAATTGTTATGAAGCCCAGGGGG - Intronic
1036334296 8:7858133-7858155 CAATTGTTATGAAGCCCAGGGGG + Intronic
1039752607 8:40492194-40492216 CGACTGTAAGGAAGCCCAGGAGG + Intergenic
1041970664 8:63738318-63738340 CAATTGTTATGAAACCATGTTGG - Intergenic
1042357802 8:67848245-67848267 CAAATGTTTTAAAGCCCAGTTGG + Intergenic
1188563019 X:31491623-31491645 CAGTTGTTATGCTGCCCAGCTGG + Intronic
1191903643 X:66064712-66064734 AAATTGTTATGAAGTTCAGCTGG + Intergenic
1198756017 X:139983409-139983431 CAATTGCTGTGAAGGGCAGGTGG + Intergenic
1199668447 X:150120892-150120914 AAATTGTTATGAAGTTCAGCTGG - Intergenic
1200683009 Y:6235320-6235342 CAATTTGAATGAAGCCCTGGAGG - Intergenic
1201049624 Y:9919061-9919083 CAATTTGAATGAAGCCCTGGAGG + Intergenic