ID: 1036289127

View in Genome Browser
Species Human (GRCh38)
Location 8:7471827-7471849
Sequence GAAAAGGAACAGATGCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 2, 1: 0, 2: 2, 3: 32, 4: 389}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036289127_1036289133 15 Left 1036289127 8:7471827-7471849 CCCTGTTGCATCTGTTCCTTTTC 0: 2
1: 0
2: 2
3: 32
4: 389
Right 1036289133 8:7471865-7471887 GGCTGCTAATCCTCGCACCAGGG 0: 2
1: 0
2: 0
3: 0
4: 65
1036289127_1036289132 14 Left 1036289127 8:7471827-7471849 CCCTGTTGCATCTGTTCCTTTTC 0: 2
1: 0
2: 2
3: 32
4: 389
Right 1036289132 8:7471864-7471886 GGGCTGCTAATCCTCGCACCAGG 0: 2
1: 0
2: 0
3: 3
4: 48
1036289127_1036289131 -6 Left 1036289127 8:7471827-7471849 CCCTGTTGCATCTGTTCCTTTTC 0: 2
1: 0
2: 2
3: 32
4: 389
Right 1036289131 8:7471844-7471866 CTTTTCTACAAAGCAGAAACGGG 0: 2
1: 0
2: 4
3: 30
4: 529
1036289127_1036289130 -7 Left 1036289127 8:7471827-7471849 CCCTGTTGCATCTGTTCCTTTTC 0: 2
1: 0
2: 2
3: 32
4: 389
Right 1036289130 8:7471843-7471865 CCTTTTCTACAAAGCAGAAACGG 0: 2
1: 0
2: 0
3: 32
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036289127 Original CRISPR GAAAAGGAACAGATGCAACA GGG (reversed) Intronic
901408506 1:9066561-9066583 GAAAAGAAAAAGGTACAACAAGG - Intronic
902137858 1:14326292-14326314 GGAAAGGAACAGACACAACAAGG - Intergenic
902215221 1:14930556-14930578 CAAAAGGAACACATGTAACAAGG - Intronic
903386922 1:22933124-22933146 GAAAAAGAACAGATGAAAGAAGG - Intergenic
904132210 1:28283282-28283304 GAAAATGAACAGATACCTCAAGG - Intergenic
905466023 1:38154030-38154052 GAACAGGAATAGAAGCAAAAAGG - Intergenic
907011055 1:50963559-50963581 GAAATTGTACAGAGGCAACATGG - Intronic
908829363 1:68164009-68164031 GAAAAGGAAGAGATGATCCATGG + Intronic
909053833 1:70799671-70799693 GAAAATGAACATATACACCATGG + Intergenic
909543142 1:76813393-76813415 GAAAAACAGCAGATGCAAGAAGG - Intergenic
909617046 1:77622510-77622532 GAAAAAGAACATATTCACCATGG + Intronic
909639913 1:77861568-77861590 GAGAAGGAAGAGAGGGAACAAGG - Intronic
909807157 1:79885561-79885583 TAAAATGAAAAGATGCCACATGG - Intergenic
910302683 1:85724695-85724717 ATAAAGGAACGGATGCAAAAAGG + Intergenic
911263673 1:95717895-95717917 GAAAAGGAACAATTGGAGCAAGG + Intergenic
911597615 1:99814752-99814774 GAGAAGTAAGAGATGAAACAAGG - Intergenic
912197760 1:107419284-107419306 TAAAAGGAAAAGTTCCAACAAGG - Intronic
913517419 1:119616328-119616350 GAAAGGAAACAGACGCAAGAAGG - Intergenic
915264390 1:154705859-154705881 GAAATGGAACTAATGCCACAAGG + Exonic
916014893 1:160741308-160741330 GAAAAGAACCAGAAGAAACAAGG + Intronic
916484152 1:165243296-165243318 GATAAGTAAGAAATGCAACATGG + Intronic
916541346 1:165757985-165758007 GAAAATGAAGACATTCAACATGG - Intronic
918306528 1:183251671-183251693 GTAAATGAACAGATGCCACCAGG + Exonic
919194159 1:194262697-194262719 GAAAATGTACATATACAACATGG + Intergenic
919324515 1:196089781-196089803 GAACAGGAACCCATGCCACATGG + Intergenic
919325019 1:196096755-196096777 GAAAACAAAAAGATGCAATAAGG - Intergenic
919507482 1:198417434-198417456 GTAGAGGACCAGATCCAACAGGG - Intergenic
921620630 1:217322476-217322498 GAAAATGAAAAGATGGAAAATGG + Intergenic
922170924 1:223153863-223153885 GAAGAGGAACAGAAGGGACAAGG - Intergenic
923139509 1:231149120-231149142 GAAAAGGCACAGTTAAAACATGG - Intergenic
923153829 1:231258348-231258370 TAAAAGGGACAGATGGAAGAAGG - Intronic
924015772 1:239720112-239720134 GTAAAGACACAGATACAACACGG - Intronic
924324601 1:242883094-242883116 GAAAAGGGGCAGCTGAAACATGG - Intergenic
1063450977 10:6149941-6149963 GAAAATGTACATATACAACATGG - Intronic
1063566548 10:7176291-7176313 GAGAAATAACAGAAGCAACATGG - Intronic
1065450710 10:25853374-25853396 GATAAGGAACAGAGAAAACAGGG + Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067043864 10:42973822-42973844 GAAATGGAAAAGATGCATCAGGG - Intergenic
1068801195 10:61141960-61141982 GAGAAGGTACAGATGAAACAGGG - Intergenic
1069068723 10:63973335-63973357 GAAAAGGACCAGAGGACACACGG + Intergenic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1071709559 10:88036473-88036495 GAAAAGAAATAAATTCAACAGGG - Intergenic
1071881669 10:89905576-89905598 CAACAGGAACAGAACCAACAGGG - Intergenic
1072501898 10:96025956-96025978 AAAAAGGAAGAAATGCAATAGGG + Intronic
1073505798 10:103988273-103988295 GAAAAATAGCAGATGCAAGAAGG - Intronic
1074084086 10:110194377-110194399 GAAAAAGAACAGGTGCATCCAGG + Intergenic
1074271942 10:111962632-111962654 CAAAGGGAACAATTGCAACAGGG - Intergenic
1074447099 10:113529677-113529699 GGAAAGGAGCAGAGGCCACATGG + Intergenic
1074490864 10:113938453-113938475 GAATGGGAACGGATGCATCAAGG - Intergenic
1075421304 10:122302583-122302605 GCCATGGGACAGATGCAACAAGG - Intronic
1076173838 10:128348538-128348560 GAAAAGTAACAATTCCAACAAGG - Intergenic
1076370800 10:129951859-129951881 GAAAAGGAAGAGCTGCATTATGG - Intronic
1076433319 10:130422726-130422748 GAAGAGGAACAGCTGAAATAGGG - Intergenic
1078012171 11:7580886-7580908 AAAGAGGAACAGATGGAACCAGG + Intronic
1078597918 11:12704423-12704445 GCAAAGGCACAGAGGCAAAAAGG - Intronic
1078907996 11:15705188-15705210 GAAGAGGAAAAGAGGCACCAGGG + Intergenic
1079146023 11:17852683-17852705 AAGTAGGTACAGATGCAACAGGG + Intronic
1079451412 11:20602330-20602352 GTAAAGGATCAAATGCAAGAGGG - Intronic
1079491956 11:20998966-20998988 GAAAAGCAGCAAATGCAACTTGG + Intronic
1079967047 11:26992689-26992711 GAAAAGAAACAGAGGAAGCATGG - Intergenic
1079991767 11:27253772-27253794 GACATGGAACTGAGGCAACAAGG - Intergenic
1080161649 11:29183858-29183880 GAAAAGGAAAGGATGCAGCAAGG - Intergenic
1081006746 11:37753825-37753847 GAACAAGAACAGATAAAACAAGG + Intergenic
1081224582 11:40504443-40504465 GAATATGAACAGATGCCACTTGG + Intronic
1082774184 11:57233378-57233400 GAAAAGGAAGAAAAGAAACAGGG - Intergenic
1083428093 11:62599649-62599671 GAAAAGGGAAAGATGTAAAATGG + Intronic
1085992673 11:81869265-81869287 AAAAAGGAACTGAGGCAACTTGG - Intergenic
1086455541 11:86955725-86955747 GAAAGGGGGCAGATGGAACAGGG - Intergenic
1086534557 11:87829318-87829340 GAAAATGAACTGATACAACAGGG - Intergenic
1087434773 11:98100642-98100664 GAAAAGGTACAGTTAAAACATGG - Intergenic
1090592417 11:128286661-128286683 TAAAAGGAAAAGAGGCATCAAGG - Intergenic
1091612567 12:2023780-2023802 TAAAAAGGACAGATGTAACATGG + Intronic
1092369557 12:7905371-7905393 GGAAAGGAAGAGATGTAAAAAGG - Intergenic
1092514541 12:9195415-9195437 GAAAAGGAAAAGAAGGAAAAAGG - Intronic
1093589116 12:20878780-20878802 GAAATGGAAAAAATGTAACAGGG + Intronic
1094749440 12:33388659-33388681 GAAAAGGAGCATATGAAAAAAGG + Intronic
1094809026 12:34120005-34120027 GATTAGGAACATATGCAGCATGG + Intergenic
1095174170 12:39071642-39071664 AAAAAGAAAAAGAAGCAACATGG + Intergenic
1095395643 12:41759333-41759355 GAAAAGGAACAGCATCAAGAAGG - Intergenic
1095517844 12:43026823-43026845 GATAAGGAAGAGATCAAACATGG + Intergenic
1095602181 12:44026389-44026411 GAAAAGCAACAGAGGCATCTGGG - Intronic
1098938692 12:76509789-76509811 GATGAGGAAGACATGCAACAGGG + Intronic
1099027482 12:77483704-77483726 CAACAGGAACAGAGTCAACAAGG - Intergenic
1099106505 12:78503409-78503431 GAAAAGGAACAGAAGTAATTGGG - Intergenic
1099885681 12:88527189-88527211 GAAAAGGAGCTGCTTCAACAAGG - Intronic
1101973260 12:109332557-109332579 GAAAATGAAAAGCTGCACCAGGG - Intergenic
1102551309 12:113694117-113694139 GGAGAGGGACAGATGCTACATGG - Intergenic
1103235054 12:119365267-119365289 CAAAAGGGACAGATTCAAGAAGG + Intronic
1103412528 12:120722656-120722678 GCAAAGGAACAGAAGCAGGAGGG - Exonic
1104330806 12:127842964-127842986 GAAAAGAAAAAGATGGATCAAGG - Intergenic
1104490555 12:129190009-129190031 AAAAAGTCAGAGATGCAACACGG + Intronic
1105901305 13:24756651-24756673 GAAAGGGAACGGATGCCACAAGG - Intergenic
1106633864 13:31506433-31506455 GAAATGGAATAGATTCAAAATGG - Intergenic
1106966720 13:35079855-35079877 GAAAATGAATAGTTGCAAAAGGG - Intronic
1107259123 13:38470256-38470278 GAAAATAAACAGAAGCATCAAGG - Intergenic
1107583325 13:41816036-41816058 GAATAGGAACAGATTTAAAATGG + Intronic
1108030732 13:46226560-46226582 GAAGAGGAATATATGCCACAAGG - Intronic
1109180158 13:59203995-59204017 GAAAAACAGCAGATGCAAGAAGG - Intergenic
1109869229 13:68310437-68310459 GAAAAGGACCATATGCATAAAGG + Intergenic
1110142426 13:72147228-72147250 GTAAAGGATCAGAGACAACAAGG - Intergenic
1110530522 13:76592200-76592222 GATAAGCAACAGATGCCACTGGG + Intergenic
1111479301 13:88801474-88801496 GAAAAACAGCAGATGCAAGAGGG - Intergenic
1111977415 13:94981135-94981157 GACTAGGAACAGATACAACCTGG + Intergenic
1112645483 13:101326887-101326909 GAAAAGGAGAAGAGGCCACATGG - Intronic
1112753884 13:102609165-102609187 GAAAAGGAACTAATACAAAAAGG - Intronic
1112859954 13:103818323-103818345 CAAAAGGGAGAGATGCAAAATGG + Intergenic
1114233865 14:20807317-20807339 GAAAAACAGCAGATGCAAGAAGG + Intergenic
1114238665 14:20846105-20846127 CTAAAGGAACAGAGTCAACAAGG + Intergenic
1115097951 14:29661534-29661556 GAAAGGGAACAAAGGCAACAGGG + Intronic
1116020011 14:39448834-39448856 GAACAAGAACAGATGTAGCATGG - Intergenic
1116182980 14:41558821-41558843 GAAAAACAGCAGATGCAAGAAGG + Intergenic
1116606858 14:47010099-47010121 GTAAAGGCAAAGATGCCACAGGG - Intronic
1116707487 14:48320528-48320550 GAAAAGGAACACATACATAAAGG + Intergenic
1116856193 14:49954517-49954539 TTAAAGCAACAGCTGCAACATGG - Intergenic
1119696872 14:76720280-76720302 GAAAAACAGCAGATGCAAGAAGG - Intergenic
1119729019 14:76939425-76939447 GAAAATGAACAGAATGAACAGGG - Intergenic
1120484926 14:85101505-85101527 AAAAATGAACAAATGAAACAAGG - Intergenic
1120882400 14:89424171-89424193 GAAAGGGAACAAAGGGAACATGG - Intronic
1121577158 14:94997638-94997660 GAGAAAGAACACAGGCAACATGG - Intergenic
1122250949 14:100439253-100439275 GACAAGCAACAGATGCCAAAGGG - Intronic
1124392826 15:29275087-29275109 GAAAAATAGCAGATGCAAGAAGG - Intronic
1125706625 15:41742964-41742986 GAAAAGCAACTGAAGCCACAGGG - Exonic
1126436239 15:48641308-48641330 AAAAAAGAACACCTGCAACAGGG + Intronic
1126703034 15:51384512-51384534 GAAAAGGCCCAGAAGCACCAAGG + Intronic
1127706592 15:61553158-61553180 GAGAAGATACAGATTCAACATGG + Intergenic
1128190345 15:65688026-65688048 CAAAAGGAACAAATGAAATATGG - Intronic
1129133621 15:73524965-73524987 GAACTGCAACAGATGAAACATGG + Intronic
1129761747 15:78132761-78132783 GAAAAATAGCAGATGCAAGAAGG - Intronic
1130162565 15:81415664-81415686 CAAGAGCAACAGGTGCAACATGG - Intergenic
1130309729 15:82742706-82742728 GAAAAGGAACTGCTGCAAATAGG - Intergenic
1130819897 15:87483904-87483926 TACAAGAAACAGAAGCAACAAGG - Intergenic
1130831609 15:87606899-87606921 GAAAAGGAAGAGATTCAGTAAGG + Intergenic
1131148708 15:90033531-90033553 AAAAAGGAACATATGGGACAAGG - Intronic
1132477300 16:147014-147036 GAAAATGAACACATATAACATGG + Intergenic
1135186326 16:20318998-20319020 GCTAAGGAACTGATTCAACAGGG + Intronic
1135263543 16:21001574-21001596 GAAAAGAAACAGATGAGACAAGG + Intronic
1137462165 16:48674887-48674909 GAAAAAGATCAGATGGAAGAAGG + Intergenic
1138914463 16:61446540-61446562 GAAAAGGAACTGGTGAGACAGGG - Intergenic
1139184987 16:64795279-64795301 GAACAAGAACAGATTGAACACGG - Intergenic
1139675248 16:68519161-68519183 GAAAAGGATCACGTGTAACAAGG + Intergenic
1139690204 16:68636389-68636411 GGTCAGGAACAGATGCAAAAAGG + Intronic
1139838317 16:69858069-69858091 GAAAAGGAACAAAACCAACCGGG - Intronic
1143433118 17:6901480-6901502 TAAAAGGAACATATACAATACGG + Intronic
1144255828 17:13466081-13466103 GAAATGGAATAGATTCATCAGGG + Intergenic
1145126758 17:20307345-20307367 CAAAAGGAACAGATTAAAGATGG - Intronic
1145901096 17:28491009-28491031 GAGAAGAAAGAGATGCAAGAAGG + Intronic
1146366473 17:32232907-32232929 GAAAAGTAAGAGATGTAAGAGGG - Intronic
1147703432 17:42410158-42410180 GAGAAGGGACAGATGCCACATGG + Intronic
1148673150 17:49428068-49428090 AAAAAGGAAGAGATGAAAGATGG + Intronic
1149342706 17:55702892-55702914 GAAAAGGAACCAATCAAACATGG - Intergenic
1150549940 17:66200786-66200808 GGAAAGGAATAGATGCCACTAGG + Intergenic
1151097922 17:71520688-71520710 GAAAATGATCAGCTGCAAGAGGG + Intergenic
1152031946 17:77848153-77848175 TAAAAGAAGCTGATGCAACAGGG - Intergenic
1203212582 17_KI270730v1_random:92420-92442 GGAATGGAACAGATGTAAAATGG + Intergenic
1153113827 18:1629108-1629130 GACAAGAAAAAGATGCAAAATGG + Intergenic
1154284764 18:13042706-13042728 GAAAAGGAATACATGCCACATGG - Intronic
1155870207 18:31017555-31017577 TAAAAGGATCAGATACAACCAGG + Intronic
1155914600 18:31543502-31543524 GAAGATGATCAGATGCAATAAGG + Intronic
1156505217 18:37586397-37586419 GAAAAGGAACATAAGCCAGATGG - Intergenic
1156876747 18:42023855-42023877 GAAAGGGAACAAATGAAAAAAGG - Intronic
1157269188 18:46257772-46257794 CAAAAGGAACTGTTCCAACACGG - Intronic
1157302090 18:46486380-46486402 GAAAAGTTACAGAGGCAAAAGGG - Intronic
1157352869 18:46905978-46906000 AAAAAGGAACAGATAGATCAGGG + Intronic
1158133807 18:54183731-54183753 GAAAGGGAACAAATGCTAAAAGG + Intronic
1158758956 18:60361243-60361265 GAAAAGGTAGAGATGTGACATGG + Intergenic
1167730329 19:51249550-51249572 GAAGGGGAACTGCTGCAACAGGG + Intronic
1168587490 19:57605227-57605249 GGAAAGGAACAGGTGACACATGG - Intronic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925616450 2:5748549-5748571 GACATGGCTCAGATGCAACAGGG - Intergenic
927154154 2:20212217-20212239 GAAAATGACCAGGTCCAACATGG + Intronic
927281869 2:21315835-21315857 GACAAGGAAGAGATGTAACAAGG - Intergenic
927437915 2:23086185-23086207 GAAAAGGTACAGTTAAAACATGG - Intergenic
928039558 2:27861295-27861317 GAACAGGAATAGATGCTATACGG - Intronic
928257844 2:29740314-29740336 AAAAAGGAACGGATGAAAGAAGG + Intronic
928971402 2:37033641-37033663 TAAAAGTATAAGATGCAACATGG + Intronic
929203369 2:39262185-39262207 GAAAAGTAAAAGGTGCAACGGGG + Intronic
929222195 2:39476298-39476320 GAAATGGAACAGAAACAATATGG - Intergenic
929364854 2:41141672-41141694 AAACAGGAAAAGATGCAAAAAGG + Intergenic
929424552 2:41830777-41830799 GATAAGAAACAGAAGCAACAGGG - Intergenic
929428398 2:41867315-41867337 GAAATGGAACAGTAGCAAAAAGG + Intergenic
930692841 2:54381906-54381928 GAAAAGGAACAGAGAGATCACGG + Intronic
931056594 2:58479277-58479299 CACAAGGCACAGATGCATCAAGG + Intergenic
932406010 2:71513077-71513099 GAGAAGGAACAGGTGCCACTGGG + Intronic
933451509 2:82458893-82458915 GAAAAGGAAAAAATGCCTCATGG - Intergenic
934030861 2:88045403-88045425 AAACAGCAACACATGCAACACGG + Intronic
935813622 2:106825698-106825720 GAAAAGAAAAGGATGCATCAAGG - Intronic
935987637 2:108689869-108689891 GAATTGGAAGAGAAGCAACATGG - Intergenic
936126465 2:109792570-109792592 GAATTGGAAGAGAAGCAACATGG - Intergenic
936218228 2:110578898-110578920 GAATTGGAAGAGAAGCAACATGG + Intergenic
937720051 2:125083955-125083977 GAAAAAGAAAAGAAGCAACTTGG + Intergenic
938044655 2:128107083-128107105 GGAAAGAAACAGAAGGAACAGGG - Intronic
940789850 2:158020575-158020597 GAAGAAGGACAGATGCAACATGG + Intronic
941748586 2:169112285-169112307 GAAAAACAACAGAAGCAAGAAGG + Intergenic
942410880 2:175708249-175708271 TGAAAGAAACAGAAGCAACAAGG - Intergenic
942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG + Intronic
944322618 2:198365829-198365851 TATGAGGAACAGATGCAAGATGG + Intronic
944460496 2:199944550-199944572 GTAAAGGAATAGATGCAATCTGG - Intronic
947509055 2:230734181-230734203 GAAAAGGAAGAGGTGCATCTGGG + Intronic
948165429 2:235857534-235857556 AAAAAGGAACAGCTGCAATCAGG - Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
1170427507 20:16249550-16249572 GAAAAAGAGCAAATGCAAGAAGG + Intergenic
1170914021 20:20605180-20605202 CAAAAGGAAAAGAAGCAACGAGG - Exonic
1171155141 20:22865074-22865096 GAAATGGAACAGGGGCAGCAGGG + Intergenic
1173477974 20:43376221-43376243 GAAATAGGACAAATGCAACAGGG - Intergenic
1173978038 20:47202077-47202099 GCAAAGAAACAGATGCACCGAGG - Intergenic
1174394107 20:50235443-50235465 GAAAAAAAACAGATGAAAAATGG - Intergenic
1174604576 20:51751554-51751576 AAAAAGGAATAGGAGCAACAGGG - Intronic
1175042476 20:56067864-56067886 GAAAATTAACATATGAAACAAGG + Intergenic
1175353447 20:58343182-58343204 GAGAAGTAACAGCTGCACCAAGG - Intronic
1177010683 21:15727656-15727678 GAAAAGGGAAAGAGGCAAGAAGG + Intergenic
1177286848 21:19062685-19062707 GAAAAACAACAGATGCAAGAAGG + Intergenic
1177863999 21:26491076-26491098 GAAAAGAAAAATATGAAACATGG + Intronic
1178616726 21:34141066-34141088 GAAAAGGAACAAATTCAGCAAGG - Intronic
1180604646 22:17048300-17048322 GAAATGGAACAGATGAGAAAAGG + Intergenic
1181534183 22:23533242-23533264 GAAAAGGAAGAGGTGGAAAAAGG + Intergenic
1181558776 22:23687643-23687665 GAAATGGAACAAATACAAGAAGG - Intergenic
1181856821 22:25787689-25787711 TGAAATGAACAGATGCAACGAGG + Intronic
1183122075 22:35737913-35737935 GAAACGAAACAAATGCAGCAAGG + Intergenic
1183922257 22:41178399-41178421 CACATGCAACAGATGCAACAAGG + Exonic
1184780104 22:46644213-46644235 GAACAGGGACAGGTGTAACATGG - Intronic
1184780108 22:46644235-46644257 GAACAGGGACAGTTGTAACACGG - Intronic
1184780111 22:46644257-46644279 GAACAGGGACAGATGTAATACGG - Intronic
1184780114 22:46644279-46644301 GAACAGGGACAGGTGTAACATGG - Intronic
1184780123 22:46644323-46644345 GAACAGAAACAGGTGTAACACGG - Intronic
1184780145 22:46644433-46644455 GAAAAGGGACAGATGTAACACGG - Intronic
1184780161 22:46644521-46644543 GAACAGGGACAGGTGTAACACGG - Intronic
1184780176 22:46644587-46644609 GAACAGGGACAGATGTAACCCGG - Intronic
949607458 3:5670014-5670036 CCAAAGGAACAGAACCAACAGGG + Intergenic
949781582 3:7694986-7695008 GATAAGAAACACATGCAATACGG + Intronic
951745891 3:25976960-25976982 GCAGAGAAACAGATGCAAAAAGG - Intergenic
952032098 3:29155525-29155547 GAAAGGGCACAAATGGAACAAGG - Intergenic
952102998 3:30036531-30036553 GAAAAGAAGTAGATGCAACTGGG - Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
952737526 3:36705218-36705240 GAAAATAAACAGAAGCACCATGG - Intergenic
952783849 3:37132462-37132484 GGAAAGGAACAGAAAGAACATGG + Intronic
953127840 3:40109050-40109072 GGAAAGGAACAGATGAGAAAAGG - Intronic
953585956 3:44201406-44201428 GGATTGGACCAGATGCAACAAGG - Intergenic
953751969 3:45615907-45615929 GAAAAACAGCAGATGCAAGAAGG - Intronic
955039944 3:55306508-55306530 GAAAACAAATATATGCAACAGGG + Intergenic
955837006 3:63067130-63067152 GAAAGGGAACGTATCCAACAGGG - Intergenic
956503818 3:69915823-69915845 GAAAAGGAACAGGGACCACAGGG - Intronic
957561441 3:81826810-81826832 GAAAACGGACTAATGCAACATGG + Intergenic
957736654 3:84212370-84212392 GAAAAAAAAAAGCTGCAACAAGG + Intergenic
958534239 3:95376571-95376593 AAAAAGCAACTGATCCAACATGG - Intergenic
958891406 3:99787354-99787376 GAAAAAGAACAGCTGAACCAAGG - Intronic
959251126 3:103947521-103947543 GAAAAGGAGTAGAAGCAAAAAGG + Intergenic
959284756 3:104392883-104392905 GAAAAATAGCAGATGCAAGAAGG - Intergenic
960018577 3:112921491-112921513 GCAAAGGAAAAGATACAAAATGG + Intronic
960081722 3:113548555-113548577 GAAAAACAACAGATGCAAGAAGG + Intronic
960507766 3:118514086-118514108 GAAAAGGAAAAGATGTCAGAAGG - Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
962137264 3:132747890-132747912 AAAAAGGAACAGAAGAAAAAGGG - Intergenic
963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG + Intergenic
964987395 3:162760949-162760971 AAAAAGTAACAGATGCTACAAGG - Intergenic
965739057 3:171853614-171853636 GAAAATGAATAGAAGCAATATGG - Exonic
966725623 3:183105605-183105627 GAAACGCAAAAGATGCAAAAGGG - Intronic
967685850 3:192415263-192415285 GAAAAGGAAAAGGTGCCACTGGG - Intronic
967713616 3:192738371-192738393 GAAAAGGAACTGAGGCTCCAAGG + Intronic
968027683 3:195456269-195456291 GAAGAGGAGCAGATACACCAAGG - Intergenic
969874021 4:10122790-10122812 GAAAAGCAAGTGATGCAACCAGG + Intergenic
970195233 4:13544987-13545009 GAAAAGAAACAGATAAAACCAGG - Exonic
970412933 4:15827554-15827576 AAAAAGGAAAACATGGAACATGG - Intronic
971511177 4:27426221-27426243 CAAAAGGAACTGATGCTTCAAGG - Intergenic
972176647 4:36416356-36416378 GGAAAGAAACAGAAGCTACAGGG - Intergenic
972374569 4:38458458-38458480 GCAGAGGAAAAGATGAAACAAGG + Intergenic
972896421 4:43626606-43626628 GAAAAGGCAAAGAGGCAAAATGG + Intergenic
973978541 4:56286575-56286597 GAATTGGAAAAGATGCAACTTGG + Intronic
974895386 4:67931929-67931951 GAAAAGGAACAAAGGAGACAGGG - Intronic
975378546 4:73672149-73672171 GAAAGGGAACATATGTATCAGGG + Intergenic
975808176 4:78135239-78135261 GAAAAAGAAAAGATGCAAGAAGG - Intronic
977460840 4:97322903-97322925 GAAAAACAGCAGATGCAACAAGG - Intronic
979662176 4:123269756-123269778 GAAAAAGAAAAGATGCATTAAGG - Intronic
979668843 4:123341499-123341521 TAGAAGGAACAGATGGGACATGG + Intergenic
980188867 4:129497083-129497105 GCAAAGGAAAAGATGGAGCATGG - Intergenic
980637670 4:135529619-135529641 AAAAGGGAACAGTTTCAACAAGG + Intergenic
982019994 4:151193668-151193690 GACATGGAACAGATACAACTTGG + Intronic
982202200 4:152972012-152972034 GAAGAAGAACAGATGCAAAATGG + Intronic
983151974 4:164295333-164295355 GAAAAACAGCAGATGCAAGAAGG - Intronic
984680006 4:182596446-182596468 AAAAAGGGACAGATACAATAAGG + Intronic
984818472 4:183859325-183859347 GAAAACAGACAAATGCAACAGGG + Intronic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
985032874 4:185809274-185809296 GAACAGGGACAAATGCAATATGG + Intronic
986865700 5:11983963-11983985 GAAAAAGAACAGATGTTACAGGG + Intergenic
987106093 5:14641035-14641057 GAAAAGGAAGCGATGCGGCATGG + Intergenic
987397607 5:17439723-17439745 AACAAGGAACAGATGAAAGACGG - Intergenic
987729072 5:21744366-21744388 GAAATGGAACAGATAAAACAGGG + Intergenic
987958531 5:24772168-24772190 GAGAAGGGACAATTGCAACAGGG + Intergenic
988156865 5:27464238-27464260 AAAAAGGAACAGGTGAAAGAAGG + Intergenic
988342785 5:29996100-29996122 GAAAATGAAGAAATCCAACATGG - Intergenic
991069247 5:62458255-62458277 GATAAGAAACAGAATCAACATGG - Intronic
993653628 5:90552171-90552193 GAAAAGGAACAGGTAGAAAAGGG - Intronic
993715108 5:91268664-91268686 AAAAAGGAACAGGTGAAAGAAGG - Intergenic
994654162 5:102568906-102568928 GAAAATGAAGGGATGCAAAAGGG - Intergenic
994804141 5:104421438-104421460 GAAGAGGTAAAGATCCAACAAGG - Intergenic
995584463 5:113633264-113633286 GAAAAGGAACTGGTGAAAAAAGG + Intergenic
996646518 5:125824736-125824758 GAAAAGGAAAAGAATCAATAAGG - Intergenic
996968035 5:129329269-129329291 GAAATGGAACAGATGTCTCAGGG - Intergenic
997553458 5:134773810-134773832 GAAATCGAAGAGATGAAACAAGG + Exonic
998084630 5:139308972-139308994 CTAAAGGGACAGATGTAACATGG - Intronic
998587854 5:143447098-143447120 GAGATGGGAAAGATGCAACATGG - Intergenic
1001780219 5:174361820-174361842 GTAAACGATCAGATCCAACAGGG + Intergenic
1003278485 6:4672594-4672616 GCACAGGTACAGATGCAAGAAGG - Intergenic
1003529744 6:6927856-6927878 GGGAGGGAACAGATGCAACCAGG + Intergenic
1005804215 6:29459002-29459024 GAAAAGGACCAGAAGAAACAGGG + Intronic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1007732913 6:43960743-43960765 GAAAAGAAAGACATGAAACACGG + Intergenic
1009714924 6:67378985-67379007 GAAAAGGAAGAAAGGGAACAGGG - Intergenic
1012336652 6:98067866-98067888 GAAAAGAAATAGAGACAACATGG - Intergenic
1012424724 6:99101276-99101298 GAACAAGAACAGGGGCAACAGGG + Intergenic
1012780885 6:103556434-103556456 GTAAAGGAACAGAGTAAACAAGG - Intergenic
1013026068 6:106272931-106272953 GAAAAATAATAGATGAAACAAGG + Intronic
1013418933 6:109948970-109948992 GGAAAGGAACAGATGAGGCAGGG + Intergenic
1014211169 6:118709758-118709780 GGAAAGGAACAGATGGCAAATGG - Intronic
1014394665 6:120911325-120911347 GTAAAAGAAAAGATACAACAGGG - Intergenic
1014595423 6:123331279-123331301 GAAAGGCTAGAGATGCAACATGG + Intronic
1015982193 6:138850488-138850510 TAAAAGGAACACATACAACATGG - Intronic
1016516534 6:144898542-144898564 GAAAAGCAACAGACTCACCATGG + Intergenic
1016601978 6:145872816-145872838 GAAAATGTACATATACAACATGG + Intronic
1016879895 6:148900684-148900706 AAAAAGGAACAAATACAATATGG - Intronic
1017833805 6:158157816-158157838 GACAAGTAACAGATCCAACCGGG + Intronic
1018133355 6:160753383-160753405 GATAAGGAACAGCTGCACAAAGG + Intergenic
1019091004 6:169533577-169533599 GAAAAGGCAGAGAGGCAAGAGGG + Intronic
1020017876 7:4842058-4842080 AAAAAAAAAAAGATGCAACAAGG + Intronic
1020481458 7:8667851-8667873 GAAAAGGAATAAATAAAACATGG - Intronic
1021035947 7:15799149-15799171 AAAACTGAAAAGATGCAACAAGG + Intergenic
1021206769 7:17789870-17789892 GAAAAGGGAAAGATGGAAAAAGG - Intergenic
1022265399 7:28748833-28748855 GGAAAGGAATAAATGCAAGAGGG + Intronic
1022716613 7:32904471-32904493 GAAAAACAGCAGATGCAAGAAGG + Intergenic
1022793638 7:33714499-33714521 GAAAAGGAACAGCAGGAGCAGGG - Intergenic
1023802633 7:43848205-43848227 TAAAGGGAACAGATGAAGCAGGG + Intergenic
1023845075 7:44115988-44116010 GAGAAGGAACAGATGCTAGGTGG + Intronic
1024764495 7:52641120-52641142 GAAATGGAACACTTCCAACATGG - Intergenic
1024887862 7:54164960-54164982 GACAAGGAACTGAAGCAACAGGG + Intergenic
1027247192 7:76375208-76375230 GAAAAGAAACAGACACACCATGG + Intergenic
1027583031 7:80021584-80021606 GAAAAGGAACAAAGCCTACAAGG + Intergenic
1031142334 7:117956903-117956925 GAAGAGAAAAATATGCAACAAGG - Intergenic
1031205486 7:118751819-118751841 GCAGAGGAACAGATGCAGGAGGG - Intergenic
1031779975 7:125948567-125948589 GAAAAGGAGAAGATCCAGCATGG + Intergenic
1032998731 7:137479125-137479147 GAAAAGTCACAGATCCAAAATGG - Intronic
1033136848 7:138792536-138792558 GAAAAGGAACATAAGCTAGATGG + Intronic
1034079207 7:148261147-148261169 GAAAAACAACAGATGCACAAAGG - Intronic
1036064411 8:5363100-5363122 GAAAGGGAACATATGCAAATAGG - Intergenic
1036090574 8:5660869-5660891 GAAAAGGGAAACAGGCAACAGGG - Intergenic
1036289127 8:7471827-7471849 GAAAAGGAACAGATGCAACAGGG - Intronic
1036332348 8:7839700-7839722 GAAAAGGAACAGATGCAACAGGG + Intronic
1038345393 8:26727481-26727503 GAAAATGAGCAGATCCATCAAGG - Intergenic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038895521 8:31777721-31777743 AAAAAGGAACAGATATTACATGG + Intronic
1038903637 8:31872473-31872495 GAAAACTAACAGATGCCACCAGG - Intronic
1039113433 8:34065317-34065339 GAAAAGGGAAATATGCACCAAGG - Intergenic
1039122474 8:34162795-34162817 GGAAAGGAACACAGCCAACAAGG + Intergenic
1039871715 8:41551329-41551351 GCAAAGGCACAGAAGCCACAGGG + Intergenic
1040479493 8:47811055-47811077 AAAAAGGTACAGATTCAAGAAGG + Intronic
1040905124 8:52461044-52461066 GAAAAGGAGAAGTTGCTACAGGG - Intergenic
1041010787 8:53541536-53541558 GAAAAAGAACAAATAAAACATGG + Intergenic
1041553277 8:59123915-59123937 AAATAGGAGCAGCTGCAACATGG + Intergenic
1041829609 8:62139154-62139176 GAAATGGAAAAGAAGCAAAAGGG - Intergenic
1041837498 8:62232900-62232922 CAAAAGGAACAGCAGCTACACGG - Intergenic
1042581576 8:70284906-70284928 GAAAAAGAACAGATGTCCCACGG + Intronic
1042986141 8:74584954-74584976 GGAAAAGAGCAGATGCAAAAAGG - Intergenic
1043770731 8:84196699-84196721 GATAAGGAACAAATGCCAAAAGG - Intronic
1044231446 8:89783388-89783410 GAAAAGTAATATATGCAAAAAGG - Intronic
1044327600 8:90877325-90877347 GAAAAGGAAGGGATGCACTAAGG - Intronic
1044519334 8:93179524-93179546 GAAGAGGAAGAGAAGAAACAAGG + Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1044772378 8:95650168-95650190 AAAAAGGAAGAGATACAAAAGGG - Intergenic
1044959980 8:97521102-97521124 GAAAAGGTACATATGCACCATGG + Intergenic
1045313461 8:101023789-101023811 GATAAGGATGAGATGCAGCAGGG + Intergenic
1046630008 8:116614138-116614160 AAAAAGGAGGAGATGCAAAAAGG - Intergenic
1046845003 8:118905774-118905796 GAAAAACAAGAGATGCAAAAGGG - Intergenic
1047250777 8:123180751-123180773 GAAAAGGCATAGATCCAAAAAGG + Intronic
1047460300 8:125057538-125057560 GAAAAGTAAGAAATGCATCAGGG - Exonic
1048497601 8:134948059-134948081 GAAAAGTAACAGAAGCAAGTGGG - Intergenic
1049374391 8:142282050-142282072 GAAAAGGAAGTGAAGCAGCAGGG - Intronic
1050093822 9:2043160-2043182 GAAATGGAACAGAAGCAAAATGG - Intronic
1050733071 9:8731821-8731843 GAAAAGGAAAATATACTACATGG + Intronic
1050822051 9:9890980-9891002 GAAAAGAAAAACATGCAAAATGG + Intronic
1050876254 9:10640538-10640560 GAAAAAGATCAAATGCAAAAAGG - Intergenic
1050876383 9:10642351-10642373 GAAAAGGAAGAATTGCAAGATGG - Intergenic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052161674 9:25268913-25268935 GAAAAGCAGCAGATACAATATGG + Intergenic
1052673422 9:31587650-31587672 GAAAAGGAAGAGGTCAAACAAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053119968 9:35539061-35539083 CAAAAGGGACAGACGCATCAGGG + Exonic
1053316494 9:37056290-37056312 AAGAAGGAACAGATGCAAACTGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055255004 9:74358916-74358938 TAAAAGGAACACATGGAACAGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058056713 9:100456119-100456141 AAAAAGCAGCAGATGCAGCATGG - Intronic
1058373277 9:104294454-104294476 GAAAAGGAACAAATGGAATGTGG + Intergenic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1060380268 9:123163526-123163548 GAAAAGCAAAAGATCCAAAATGG + Intronic
1061066456 9:128280810-128280832 GAAAAAGAACAAATGCGACCGGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1186764677 X:12758796-12758818 CAAAAGGAACAAATGAAAAAGGG + Intergenic
1187714390 X:22088152-22088174 GAGAATGAACTGATACAACATGG - Intronic
1188151198 X:26678095-26678117 GAACAGGAGGAGATGAAACATGG - Intergenic
1188293151 X:28413338-28413360 TAAAAGGAACATATTCAAAATGG + Intergenic
1188649706 X:32616908-32616930 GATAAGGAACAGAAGTCACAAGG - Intronic
1189231926 X:39459354-39459376 GCAAACGAACAATTGCAACAGGG - Intergenic
1189786345 X:44562006-44562028 GAAAAGGAATAGAAACAATAGGG + Intergenic
1190844693 X:54181579-54181601 GAAAATGAGCAGAAGCAAAAAGG - Intronic
1190868666 X:54406482-54406504 ATAAAGGAACAGATGCTGCAAGG + Intergenic
1192257278 X:69472573-69472595 ATAAAGGAACACATGCTACAAGG - Intergenic
1193378027 X:80784747-80784769 GAAAAGGTACATATACACCATGG - Intronic
1194136362 X:90148795-90148817 GAAATGGGCCAGATGCAAAAAGG - Intergenic
1194449743 X:94029806-94029828 GCAAAGGCACAGAAGCAAAAAGG - Intergenic
1195002511 X:100655732-100655754 GAAAAGGAAAACATGTAGCATGG + Intronic
1196283851 X:113856848-113856870 GAAAAAAAACAGAAGAAACATGG + Intergenic
1196842341 X:119870392-119870414 GAAAAGAAACACAGGCAAAATGG + Intergenic
1196996582 X:121390222-121390244 GAAAAATACCAGATGCCACATGG + Intergenic
1198025296 X:132699780-132699802 GAAAAGGAATAAAAGCTACAGGG - Intronic
1198234713 X:134726148-134726170 GAGAAGGAACAGAAGCCAGAAGG - Intronic
1199059568 X:143338445-143338467 GAAAAGCTACAGAGGCAACTGGG - Intergenic
1199155265 X:144539378-144539400 GAGAAGGAAAAGATACAAAATGG + Intergenic
1199467577 X:148156585-148156607 GAAAGTGAACAGATGTAACCAGG + Intergenic
1199503689 X:148537687-148537709 GAAAAGTAACACATGCAGCCAGG - Intronic
1200482120 Y:3718857-3718879 GAAATGGGCCAGATGCAAAAAGG - Intergenic
1201222139 Y:11782087-11782109 GAAAAGGGGCAGCTGAAACATGG - Intergenic
1201451554 Y:14121116-14121138 GAAAAGGAGCAGATGAAAAGTGG + Intergenic
1201755177 Y:17479438-17479460 GATTAGGAACATATGCAGCATGG + Intergenic
1201846375 Y:18426547-18426569 GATTAGGAACATATGCAGCATGG - Intergenic
1202126000 Y:21569374-21569396 GAAAAGGACCACCTGAAACATGG - Intergenic