ID: 1036290804

View in Genome Browser
Species Human (GRCh38)
Location 8:7487969-7487991
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900958899 1:5906985-5907007 TGGCGGGTTACCTGGGATGTGGG - Intronic
901062697 1:6480040-6480062 TTGCTATTTGCCTGTAATGCTGG + Intronic
902969563 1:20037512-20037534 GTGCTGGTTTTCTTGAATGCTGG + Intronic
905913097 1:41667262-41667284 TTGCTGGTTACCAGGCAGGATGG - Intronic
908107399 1:60859298-60859320 TGCCAGGTGACCTGGAATGCTGG + Intergenic
908905362 1:69002463-69002485 TTTCTGGTTTCCTGGAATTTTGG + Intergenic
910045811 1:82913953-82913975 TTGATTCTTACATGGAATGCAGG - Intergenic
912189283 1:107318807-107318829 TTCCTTGTTAACTGGTATGCTGG - Intronic
912612401 1:111061834-111061856 GTGCTGGTTTCCTCGCATGCTGG + Intergenic
916475959 1:165169195-165169217 TGGCTGGTTACCTGGCAGCCAGG - Intergenic
917055890 1:170981225-170981247 TTGCTGGTTAAATGGTATTCTGG - Intronic
917299804 1:173561304-173561326 TTGCTGTTTGCCTGGGATGGAGG + Intronic
918563878 1:185902742-185902764 TCGCTGGCTACCTGGAAAGCAGG - Intronic
920084602 1:203406122-203406144 TTGCTGGTAACCTGGGTAGCCGG - Intergenic
922609651 1:226916062-226916084 TAGATGTTTACCTGAAATGCAGG + Intronic
1064305740 10:14164398-14164420 TTCCGGGTTGCCTGGGATGCAGG - Intronic
1065297870 10:24293859-24293881 TTGCTGGTGTCCTGGCATGAAGG + Intronic
1067133907 10:43591589-43591611 TTGTTGGTTTACTGGAATGAGGG + Intergenic
1067382580 10:45788564-45788586 TTGCTGGAAACCTGGAAAGTAGG - Intronic
1067890284 10:50129112-50129134 TTGCTGGAAACCTGGAAAGTAGG - Intronic
1069808861 10:71143831-71143853 TTGCTGGTGACAAAGAATGCTGG - Intergenic
1070707688 10:78653149-78653171 TCTCTGTTCACCTGGAATGCAGG - Intergenic
1071483956 10:86085652-86085674 TTCCTGGTCACCAGGAAGGCAGG + Intronic
1076934562 10:133558798-133558820 ATGCTGATTATCTGGAATACAGG + Intronic
1077485531 11:2836825-2836847 AAGCTGGTTACCTGGCAGGCAGG + Intronic
1077517687 11:3011786-3011808 TTCCTGGTGACCTGGTAGGCTGG - Intronic
1078263985 11:9739203-9739225 TAGCTGGTTAGCTGGAACACAGG + Intronic
1078545922 11:12246962-12246984 GTGGTGGGGACCTGGAATGCTGG + Intronic
1078588038 11:12610888-12610910 GTGCTGGTTTTCTTGAATGCTGG - Intergenic
1078689359 11:13563433-13563455 TTGTTGGTTTACTGGAATGAGGG - Intergenic
1078870128 11:15335753-15335775 TCTCTGGGTACCTGGAATTCAGG + Intergenic
1080567643 11:33526357-33526379 GTGCTGGTTTCCTCAAATGCTGG - Intergenic
1083771719 11:64871270-64871292 TTGCTGGTGGCGTGGAAAGCAGG - Intronic
1085141473 11:74147113-74147135 TTGCTTGCTAACTGGAAAGCAGG + Intronic
1089024346 11:115253254-115253276 CTGCTGTTTCCCTCGAATGCTGG + Intronic
1089384855 11:118060748-118060770 CTCCAGGTTCCCTGGAATGCTGG + Intergenic
1091068921 11:132544629-132544651 TGGCTTTTTACCTGGCATGCTGG - Intronic
1092602597 12:10082886-10082908 GTGCTGGCTTCCTTGAATGCTGG - Intronic
1092874334 12:12835024-12835046 TTCATGGTTCCCTGGAATTCTGG - Intergenic
1095927526 12:47593768-47593790 TTGCTTGTTACCTGGGCTGGTGG - Intergenic
1098258480 12:68642892-68642914 TTGCTAGTTTCCTGAAATCCTGG - Intronic
1101101125 12:101393764-101393786 TTGCAGTTTTCCTGGACTGCCGG + Exonic
1103300191 12:119920294-119920316 GTGCTGGATACCTGGGAGGCCGG - Intergenic
1104673098 12:130693851-130693873 TTGCTTCCTGCCTGGAATGCAGG + Intronic
1104825125 12:131702398-131702420 CTGCTGTTTCCCTGGAATGTGGG - Intergenic
1109095272 13:58106483-58106505 TTGTTGGTTTACTGGAATGAGGG - Intergenic
1109975732 13:69829139-69829161 GTGCTGGTTTCCTCTAATGCTGG - Intronic
1111173456 13:84560955-84560977 TTGTTGGTTTACTGGAATGAGGG + Intergenic
1114607899 14:24012967-24012989 TGGCTGATTCCCTGGAATGGTGG + Intergenic
1116406146 14:44568363-44568385 GTGCTGGTTTTCTTGAATGCTGG - Intergenic
1116901398 14:50365515-50365537 TTTCGGGTCACCTGGAATCCTGG - Intronic
1120431291 14:84419128-84419150 ATGCTGGATACCTGAAATGTAGG - Intergenic
1123469989 15:20542858-20542880 TTGCTTGTTACCTGGGATCAAGG + Intergenic
1123648066 15:22457839-22457861 TTGCTTGTTACCTGGGATCAAGG - Intergenic
1123730283 15:23137854-23137876 TTGCTTGTTACCTGGGATCAAGG + Intergenic
1123748421 15:23335272-23335294 TTGCTTGTTACCTGGGATCAAGG + Intergenic
1124280799 15:28359149-28359171 TTGCTTGTTACCTGGGATCAAGG + Intergenic
1124301905 15:28552476-28552498 TTGCTTGTTACCTGGGATCAAGG - Intergenic
1124672847 15:31657225-31657247 TTGCTGGTCAGCTGGTAAGCGGG - Intronic
1126997370 15:54460348-54460370 GTGCTGGTTTTCTTGAATGCTGG + Intronic
1128745807 15:70113476-70113498 TTCCTCTTTAACTGGAATGCTGG + Intergenic
1128938208 15:71766254-71766276 TTTCTGGTCACCTGGAATGATGG - Intronic
1130009890 15:80142904-80142926 TTGCTGGTTTACTGGAATGAGGG - Intergenic
1134326377 16:13211774-13211796 TTGCTGTTTGCCTTGAAGGCAGG - Intronic
1137352328 16:47724441-47724463 TTGCTGGTTCCCTGAAAAGCAGG - Intergenic
1140780220 16:78289110-78289132 TTGCTGGGAACCTGGAGCGCTGG + Intronic
1141299675 16:82802315-82802337 CTCCTGGTTATCTGTAATGCTGG - Intronic
1142585531 17:970510-970532 TCGCTGGTTGCTTGGAAGGCAGG - Intronic
1145065014 17:19756149-19756171 TTGCTGATTACCTGCAGTGTGGG + Intergenic
1145219984 17:21080421-21080443 TTGTTGGTTTACTGGAATGAGGG - Intergenic
1146962275 17:36992755-36992777 TTGCTGGTTAATTGGGGTGCTGG + Intronic
1148850261 17:50551172-50551194 ATGCTGGCTGCCTGGAATGGTGG + Exonic
1149211264 17:54304159-54304181 TTTCTGGTTACCTGAGAAGCCGG - Intergenic
1150066412 17:62113307-62113329 TTTTTGGTAACCTGGAAAGCTGG + Intergenic
1150701050 17:67447227-67447249 TAGCTCGTTCCTTGGAATGCAGG + Intronic
1150896102 17:69212988-69213010 ATGCTGGTTTTCTAGAATGCTGG + Intronic
1150971961 17:70039007-70039029 TTAGTGGTTACCTGGAATTGAGG + Intergenic
1151554748 17:74841045-74841067 TTGCTGGTTCCCAGGAAGCCAGG - Intergenic
1151590726 17:75042549-75042571 TTGCTAGTTCCCTGAAATCCTGG - Exonic
1153986706 18:10357304-10357326 TGGCTGGCTTCCTGGAATGGTGG - Intergenic
1154200518 18:12296603-12296625 TTCCTGGGGACCTGGAAGGCTGG + Intergenic
1160323072 18:77914561-77914583 TACCTGGTTTGCTGGAATGCTGG - Intergenic
1164041632 19:21497769-21497791 TTGTTGGTTTACTGGAATGAGGG - Intronic
1167078355 19:47262787-47262809 TTACTAGCTACTTGGAATGCTGG + Intronic
1167520210 19:49950225-49950247 ATGCTGGTGACCCTGAATGCAGG + Exonic
1168158150 19:54489907-54489929 CGGCAGCTTACCTGGAATGCTGG - Intergenic
930774879 2:55161694-55161716 TTGCTGGGAACTTGGGATGCCGG - Intergenic
932668775 2:73719079-73719101 TTCCCTGTCACCTGGAATGCAGG - Intergenic
934053102 2:88226641-88226663 ATGCTGGTTGCCTGGAAGGCAGG + Intergenic
935043036 2:99452912-99452934 TTGCTAGTTACTTGGATTTCAGG + Intronic
935672997 2:105571600-105571622 TTGCTGGCTTCCTGGAAAACTGG - Intergenic
937758089 2:125565221-125565243 TTGCTGGACATCTGGAATGCTGG + Intergenic
938766622 2:134464200-134464222 CTGCTGGTCACATGGCATGCAGG + Intronic
938934897 2:136119052-136119074 TTGCTGGTTTCTCCGAATGCGGG - Intergenic
939745009 2:145957606-145957628 GTGCTGGTTTCCTCAAATGCCGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941161252 2:162037043-162037065 TTAGTGGTTATTTGGAATGCAGG + Intronic
943731989 2:191311826-191311848 TTACTCATTACCTGGAATGTGGG + Intronic
943783860 2:191854658-191854680 CTGCTTGTTACCTGGATTTCTGG - Intergenic
944173219 2:196801535-196801557 TTGCTGGCTATCTGGAATATGGG + Intergenic
944693177 2:202176580-202176602 TTGTTGGTTACATGCATTGCAGG - Intronic
945011031 2:205463935-205463957 TGCCTGGTTACCTGGGATGAAGG - Intronic
946927626 2:224641396-224641418 CTCTTGATTACCTGGAATGCCGG - Intergenic
947026595 2:225744167-225744189 TTGCTGGCTAGCTGGAGTTCCGG + Intergenic
1172483379 20:35284717-35284739 TTACTGGTTACTTGGTAAGCTGG - Exonic
1173017942 20:39243899-39243921 TTCCTGCTTGCCTGAAATGCAGG + Intergenic
1174236655 20:49099206-49099228 GTGCTGCATACCTGGAAGGCGGG + Intergenic
1175059034 20:56224902-56224924 TTGCTGGTTTACCGGAATGAGGG + Intergenic
1175689086 20:61052816-61052838 TAGCTGGTGCCCTGGGATGCAGG + Intergenic
1175951190 20:62584266-62584288 TTGCTGCTTACCTGGTTTGGTGG + Intergenic
1177703410 21:24668445-24668467 TTGCTGGTTACCATGAATATTGG - Intergenic
1182257144 22:29047619-29047641 TTCATGATCACCTGGAATGCTGG - Intronic
951256693 3:20458135-20458157 TTGTGGGTTAACTGGAATGAGGG - Intergenic
951594781 3:24306192-24306214 ATACTGGTTACCTGCAATTCTGG + Intronic
951690966 3:25396316-25396338 GTGCTGGTTTTCTTGAATGCTGG + Intronic
952930761 3:38359331-38359353 TTGCTGGTTTACCGGAATGAGGG - Intronic
953835003 3:46334793-46334815 TTGTTGGTTTACTGGAATGAGGG + Intergenic
953870219 3:46619718-46619740 ATGCTAGTTACCTGGAGGGCTGG - Intronic
953927096 3:46988066-46988088 TTGCTGGTTACCTGGACCCCAGG - Intronic
953944300 3:47133079-47133101 TTACTTTTTTCCTGGAATGCTGG - Intronic
954831942 3:53428407-53428429 TTACTGGTCACCAGAAATGCAGG - Intergenic
958792008 3:98662666-98662688 TTGCTGGTGACCTGCAGTTCTGG + Intergenic
964325027 3:155535866-155535888 GTGCTGGTTTTCTCGAATGCTGG - Intronic
966092787 3:176160099-176160121 GTGCTGGCTTTCTGGAATGCTGG - Intergenic
966511328 3:180766506-180766528 TTGTTGGTTTACTGGAATGAGGG + Intronic
974265185 4:59577991-59578013 TTTATTGTTACCTGGGATGCTGG - Intergenic
980899805 4:138893991-138894013 TTTCTGATTACCTGTAATGAAGG + Intergenic
982166528 4:152618298-152618320 TTGCTTTTTACCTGGCATGAAGG - Intergenic
982800246 4:159697349-159697371 GTGCTGGTTTTCTTGAATGCTGG + Intergenic
984007343 4:174328321-174328343 ATGATGGTTACCTAGAATGTTGG + Intronic
987278127 5:16384123-16384145 TTGCAGCTTACCTGGGATGGGGG + Intergenic
988048040 5:25984974-25984996 TTGATGGTTACCAGGAGTTCGGG - Intergenic
988097413 5:26634867-26634889 TTGCTGGTTAAGTGGAAAACTGG - Intergenic
988151725 5:27391560-27391582 TTGCTGGGTACATGATATGCTGG + Intergenic
993613761 5:90085125-90085147 GTGCTGGTTTCCTCAAATGCTGG - Intergenic
994941872 5:106334028-106334050 ATGGTGGTTACCAGGAATGTGGG - Intergenic
995412274 5:111872211-111872233 TTCCTGGATACCTGATATGCTGG - Intronic
997073429 5:130643546-130643568 TTGCTGGTTTACTGGAATGAGGG - Intergenic
998002920 5:138639015-138639037 TTGTTGGTGGCCTGGAATACAGG - Intronic
999743997 5:154577733-154577755 TTGGAGCTTACCTGGAAGGCAGG - Intergenic
1000241379 5:159411569-159411591 TTCCTGGTTTCATGGAATCCAGG + Intergenic
1000326615 5:160177155-160177177 TTCCTGGTTACCTGGGAGGAGGG + Intergenic
1000484582 5:161824722-161824744 TTGATGGTGACCAGGGATGCAGG - Intergenic
1002949347 6:1793721-1793743 TTTATGGTCACCTGGAATTCTGG + Intronic
1003527353 6:6909449-6909471 TTGCTGGGTCCCTGCAATGTTGG - Intergenic
1009267154 6:61569609-61569631 GTGCTGGCTTCCTTGAATGCTGG - Intergenic
1009779763 6:68255424-68255446 GTGCTGGTTTTCTTGAATGCTGG + Intergenic
1010438822 6:75868771-75868793 TTTCTGGTTTCCAGGGATGCTGG - Intronic
1014655109 6:124093224-124093246 TTTCTCTTGACCTGGAATGCAGG - Intronic
1016925443 6:149341728-149341750 TTGCTAGTTACTGGAAATGCAGG + Intronic
1026236002 7:68527902-68527924 TTACTGGGTACCTGGTATGTGGG + Intergenic
1028499582 7:91504046-91504068 TTGCTAGTTTCCTGGCCTGCTGG - Intergenic
1029010440 7:97256135-97256157 TTGCTGTTTAACTTGAATGCTGG - Intergenic
1030455207 7:109763759-109763781 TTGATGCTTACTTGCAATGCTGG - Intergenic
1032016101 7:128381210-128381232 CTGCTGGATATCTGGAGTGCAGG + Intergenic
1032498449 7:132380578-132380600 TTTCTGGGTTCCTGGAATGTTGG - Intronic
1033401195 7:141026875-141026897 GTGCTGGTTTTCTCGAATGCTGG + Intergenic
1036290804 8:7487969-7487991 TTGCTGGTTACCTGGAATGCTGG + Intronic
1036330685 8:7823568-7823590 TTGCTGGTTACCTGGAATGCTGG - Intronic
1037494421 8:19424929-19424951 TGGCTGGTTACTTGGAAGGGGGG - Intronic
1037795356 8:21988937-21988959 TTGCTGGTTTCCTTGAGGGCTGG - Intronic
1040318693 8:46278157-46278179 TTGTTGGTTTACTGGAATGAGGG + Intergenic
1040524835 8:48212179-48212201 GTGCTGGTTTTCTCGAATGCTGG - Intergenic
1041502999 8:58559800-58559822 TTACTGCTCACCTAGAATGCAGG - Intronic
1042350865 8:67776213-67776235 TTGTTGGCTTCCTGGCATGCAGG + Intergenic
1043986276 8:86696104-86696126 GTGCTGGTTTTCTTGAATGCTGG + Intronic
1047772086 8:128037737-128037759 TTTGTGTTTACCTGGAAGGCAGG - Intergenic
1047851383 8:128861192-128861214 TTGGTAGTTACTTGGAATTCAGG - Intergenic
1047894725 8:129354040-129354062 TTGCTGGGTACCTAGAATGCTGG + Intergenic
1049917368 9:331225-331247 TTGCTGATTAGCAGGAATACTGG + Intronic
1050403728 9:5284872-5284894 TAACTTGTTACCTGGGATGCCGG + Intergenic
1056472148 9:86916239-86916261 ATTCTGCTTGCCTGGAATGCAGG + Intergenic
1057011842 9:91611037-91611059 GTGCTGGTTACTGGGAATGAGGG + Intronic
1058799340 9:108530184-108530206 TTGCGGGTCACCTGGAGTTCTGG + Intergenic
1060005896 9:119999001-119999023 TTGATGTTTGCCTGGAAGGCAGG - Intergenic
1060233447 9:121842373-121842395 ATCCTGGTTACTTAGAATGCTGG - Intronic
1185883357 X:3759761-3759783 TGGCTGGATACCTGGCTTGCTGG - Intergenic
1190106838 X:47567065-47567087 CTGCTGGTGACTTGGAATGTGGG - Exonic
1190884155 X:54516487-54516509 TTCCTGGTTAAGTGAAATGCTGG - Intergenic
1194385694 X:93252073-93252095 ATGCTGGTTACCAGAAAGGCTGG - Intergenic
1197603783 X:128561002-128561024 GTGCTGGCTTTCTGGAATGCTGG - Intergenic
1198012927 X:132577698-132577720 ATGCTGGTTACCAGGGATGGAGG + Intergenic
1198080499 X:133235132-133235154 TTGCTTGTTACCTGGCATTAAGG + Intergenic
1199424252 X:147682339-147682361 TTGCTGGCTTTCTTGAATGCTGG - Intergenic
1199741662 X:150741364-150741386 TTCCTGGCTACCTGGGAAGCAGG + Intronic