ID: 1036304045

View in Genome Browser
Species Human (GRCh38)
Location 8:7587563-7587585
Sequence GCTCGTTTACGACCCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036304039_1036304045 -6 Left 1036304039 8:7587546-7587568 CCACCCCTTCCTCGGCAGCTCGT No data
Right 1036304045 8:7587563-7587585 GCTCGTTTACGACCCAAAACGGG No data
1036304038_1036304045 -1 Left 1036304038 8:7587541-7587563 CCATTCCACCCCTTCCTCGGCAG No data
Right 1036304045 8:7587563-7587585 GCTCGTTTACGACCCAAAACGGG No data
1036304040_1036304045 -9 Left 1036304040 8:7587549-7587571 CCCCTTCCTCGGCAGCTCGTTTA No data
Right 1036304045 8:7587563-7587585 GCTCGTTTACGACCCAAAACGGG No data
1036304041_1036304045 -10 Left 1036304041 8:7587550-7587572 CCCTTCCTCGGCAGCTCGTTTAC No data
Right 1036304045 8:7587563-7587585 GCTCGTTTACGACCCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036304045 Original CRISPR GCTCGTTTACGACCCAAAAC GGG Intergenic
No off target data available for this crispr