ID: 1036304547

View in Genome Browser
Species Human (GRCh38)
Location 8:7590741-7590763
Sequence AAGGGCCTATTGAATTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036304541_1036304547 8 Left 1036304541 8:7590710-7590732 CCTTCAAGTGCATGGAGTGTGAT No data
Right 1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG No data
1036304540_1036304547 9 Left 1036304540 8:7590709-7590731 CCCTTCAAGTGCATGGAGTGTGA No data
Right 1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036304547 Original CRISPR AAGGGCCTATTGAATTCTGG GGG Intergenic
No off target data available for this crispr