ID: 1036308532

View in Genome Browser
Species Human (GRCh38)
Location 8:7669175-7669197
Sequence GTCTGCACCCTGGTGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036308532_1036308539 1 Left 1036308532 8:7669175-7669197 CCCCAGGACACCAGGGTGCAGAC No data
Right 1036308539 8:7669199-7669221 GGTGTGAGTAAAAGAAAGAGGGG No data
1036308532_1036308538 0 Left 1036308532 8:7669175-7669197 CCCCAGGACACCAGGGTGCAGAC No data
Right 1036308538 8:7669198-7669220 TGGTGTGAGTAAAAGAAAGAGGG No data
1036308532_1036308537 -1 Left 1036308532 8:7669175-7669197 CCCCAGGACACCAGGGTGCAGAC No data
Right 1036308537 8:7669197-7669219 CTGGTGTGAGTAAAAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036308532 Original CRISPR GTCTGCACCCTGGTGTCCTG GGG (reversed) Intergenic