ID: 1036308536

View in Genome Browser
Species Human (GRCh38)
Location 8:7669185-7669207
Sequence ACTCACACCAGTCTGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036308536_1036308538 -10 Left 1036308536 8:7669185-7669207 CCAGGGTGCAGACTGGTGTGAGT No data
Right 1036308538 8:7669198-7669220 TGGTGTGAGTAAAAGAAAGAGGG No data
1036308536_1036308539 -9 Left 1036308536 8:7669185-7669207 CCAGGGTGCAGACTGGTGTGAGT No data
Right 1036308539 8:7669199-7669221 GGTGTGAGTAAAAGAAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036308536 Original CRISPR ACTCACACCAGTCTGCACCC TGG (reversed) Intergenic