ID: 1036308536 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:7669185-7669207 |
| Sequence | ACTCACACCAGTCTGCACCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1036308536_1036308539 | -9 | Left | 1036308536 | 8:7669185-7669207 | CCAGGGTGCAGACTGGTGTGAGT | No data | ||
| Right | 1036308539 | 8:7669199-7669221 | GGTGTGAGTAAAAGAAAGAGGGG | No data | ||||
| 1036308536_1036308538 | -10 | Left | 1036308536 | 8:7669185-7669207 | CCAGGGTGCAGACTGGTGTGAGT | No data | ||
| Right | 1036308538 | 8:7669198-7669220 | TGGTGTGAGTAAAAGAAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1036308536 | Original CRISPR | ACTCACACCAGTCTGCACCC TGG (reversed) | Intergenic | ||