ID: 1036308538

View in Genome Browser
Species Human (GRCh38)
Location 8:7669198-7669220
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036308534_1036308538 -2 Left 1036308534 8:7669177-7669199 CCAGGACACCAGGGTGCAGACTG No data
Right 1036308538 8:7669198-7669220 TGGTGTGAGTAAAAGAAAGAGGG No data
1036308532_1036308538 0 Left 1036308532 8:7669175-7669197 CCCCAGGACACCAGGGTGCAGAC No data
Right 1036308538 8:7669198-7669220 TGGTGTGAGTAAAAGAAAGAGGG No data
1036308533_1036308538 -1 Left 1036308533 8:7669176-7669198 CCCAGGACACCAGGGTGCAGACT No data
Right 1036308538 8:7669198-7669220 TGGTGTGAGTAAAAGAAAGAGGG No data
1036308536_1036308538 -10 Left 1036308536 8:7669185-7669207 CCAGGGTGCAGACTGGTGTGAGT No data
Right 1036308538 8:7669198-7669220 TGGTGTGAGTAAAAGAAAGAGGG No data
1036308531_1036308538 1 Left 1036308531 8:7669174-7669196 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036308538 8:7669198-7669220 TGGTGTGAGTAAAAGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036308538 Original CRISPR TGGTGTGAGTAAAAGAAAGA GGG Intergenic